OBJECTIVE To investigate the mechanisms of Xiaobanxia Tang(XBXT)in the prevention and treatment of chemotherapy-induced nausea and vomiting.METHODS The chemotherapy-induced rat pica model was established by intraperit...OBJECTIVE To investigate the mechanisms of Xiaobanxia Tang(XBXT)in the prevention and treatment of chemotherapy-induced nausea and vomiting.METHODS The chemotherapy-induced rat pica model was established by intraperitoneal injection of cisplatin 6mg·kg-1.Kaolin consumption was used as an indicator of nausea and vomiting.Wistar male rats were randomly divided into normal control,XBXT normal control,model,ondansetron treating,XBXT decoction high and low dose groups.The rats in ondansetron group,XBXT normal control group,XBXT high and low dose groups were gavaged ondansetron 2.6mg·kg-1·d-1,XBXT 1.6,3.2and 1.6g·kg-1·d-1,respectively 1hbefore cisplatin injection,and the administration were given every 12 h.Kaolin consumptions were weighed every 12 h.After 24 hand 72hof cisplatin injection,animals were sacrificed respectively.The contents of 5-HT,5-HIAA,dopamine(DA),DOPAC,substance P(SP),TPH,MAO and TH were measured by ELISA.The mRNA expression of 5-HT transporter(SERT),5-HT3 Areceptor,SP precursor(PPTA),NK1 and D2receptors in rat ileum and medulla oblongata were measured by RT-PCR,the protein expression were measured by Western blotting.RESULTS The high and low dosages of XBXT could significantly inhibit kaolin consumptions in cisplatin-treated rats,and reduce5-HT,increase 5-HIAA contents and reduce 5-HT3 Areceptor mRNA and protein expression,above effects are related to the reduction of TPH and the enhancement of MAOA levels.The two dosages of XBXT could significantly reduce SP and NK1 mRNA and protein expression,which was related to the reduction of PPTA mRNA expression.XBXT could also significantly reduce DA contents and D2 receptor mRNA and protein expression,which was related to the reduction of TH.CONCLUSION XBXT has significant antiemetic effect in chemotherapy-induced nausea and vomiting,the underlying mechanisms are related to the inhibition of 5-HT and5-HT3 Areceptor,SP and NK1 receptor,DA and D2 receptor.展开更多
Background and objective:Epidermal growth factor receptor(EGFR)mutations are often associated with non-EGFR genetic alterations,which maybe a reason for the poor efficacy of EGFR tyrosine kinase inhibitors(TKIs).Here ...Background and objective:Epidermal growth factor receptor(EGFR)mutations are often associated with non-EGFR genetic alterations,which maybe a reason for the poor efficacy of EGFR tyrosine kinase inhibitors(TKIs).Here we conducted this study to explore whether EGFR-TKIs combined with chemotherapy would benefit advanced lung adenocarcinoma patients with both sensitive EGFR mutation and concomitant non-EGFR genetic alterations.Materials and methods:Cases of advanced lung adenocarcinoma with EGFR mutation combined with concomitant nonEGFR genetic alterations were retrospectively collected.And the patients were required to receive first-line EGFR-TKIs and chemotherapy combination or EGFR-TKIs monotherapy.Demographic,clinical and pathological data were collected,and the electronic imaging data were retrieved to evaluate the efficacy and time of disease progression.Survival data were obtained through face-to-face or telephone follow-up.The differences between the two groups in objective response rate(ORR),disease control rate(DCR),progression-free survival(PFS)and overall survival(OS)were investigated.Results:107 patients were included,including 63 cases in the combination group and 44 cases in the monotherapy group.The ORR were 78%and 50%(P=0.003),and DCR were 97%and 77%(P=0.002),respectively.At a median follow-up of 13.7 mon,a PFS event occurred in 38.1%and 81.8%of patients in the two groups,with median PFS of18.8 mon and 5.3 mon,respectively(P<0.000,1).Median OS was unreached in the combination group,and 27.8 mon in the monotherapy group(P=0.31).According to the Cox multivariate regression analysis,combination therapy was an independent prognostic factor of PFS.Conclusion:In patients with EGFR-mutant advanced lung adenocarcinoma with concomitant non-EGFR genetic alterations,combination of TKIs and chemotherapy was significantly superior to EGFR-TKIs monotherapy,which should be the preferred treatment option.展开更多
We present a rare challenging case of metastatic non-small cell lung cancer with Epstein-Barr virus positivity that was also diagnosed with pulmonary tuberculosis at the same time. Palliative chemotherapy gemcitabine ...We present a rare challenging case of metastatic non-small cell lung cancer with Epstein-Barr virus positivity that was also diagnosed with pulmonary tuberculosis at the same time. Palliative chemotherapy gemcitabine and carboplatin was started after two weeks of anti-tuberculosis treatment with the hopes that this period would be sufficient to keep acid fast bacilli non-viable to minimise risk of tuberculosis re-activation due to chemotherapy induced immunosuppression. She completed four cycles of chemotherapy and six months of anti-tuberculosis treatment with good results and minimal side effects. Two years later, there was disease recurrence in cervical and mediastinal lymph nodes which was treated with local treatment i.e. surgery and palliative radiotherapy. It has been two years since last radiotherapy and overall more than five years since diagnosis with no active disease at present. Given the complexity and rarity of this case, significant multidisciplinary team involvement, including oncologists and radiation oncologists, pulmonologists with special interest in tuberculosis and pathologists was necessary throughout.展开更多
Effects of fibroblast-mediated IL-2 and IL-3 genetherapy on recovery of bone marrow depression in tumor-bearing mice treated with cyclophosphamide (300 mg/kg) and syngeneic BMT were investigated in the presentreport. ...Effects of fibroblast-mediated IL-2 and IL-3 genetherapy on recovery of bone marrow depression in tumor-bearing mice treated with cyclophosphamide (300 mg/kg) and syngeneic BMT were investigated in the presentreport. BALB/c mice were inoculated with J558Lplasmacytoma cells s. c. and 3 days later IL-2 secretingNIH3T3-IL-2, IL-3 secreting NIH3T3-IL-3 fibroblastcells were implanted into the tumor-bearing mice展开更多
Antitumor chemotherapy is often limited by hematopoietic toxicity.TO attenuate themyelosuppressive effects of chemotherapy, successfulengraftment of unmodified fetal liver cells (FLCs) hasbeen achieved across allogene...Antitumor chemotherapy is often limited by hematopoietic toxicity.TO attenuate themyelosuppressive effects of chemotherapy, successfulengraftment of unmodified fetal liver cells (FLCs) hasbeen achieved across allogeneic barriers in a number ofanimal models and patients, GM-CSF is a展开更多
A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT （vincristine, 175 fold-resistancehigher than that in original KB cells） and ADM（...A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT （vincristine, 175 fold-resistancehigher than that in original KB cells） and ADM（adriamycin, 14. 5 fold） resulting over-expression ofMDRl. We used the primers for antisense RNA asfollowing: upstream 5′OGAATTCTGAAACCTGTAAGCAGCAACC 3′: downstream展开更多
Background and objective Neoadjuvant chemotherapy (NACT) plays an important role in systemic chemotherapy for non-small cell lung cancer (NSCLC). P-glycoprotein (P-gp), lung resistance related protein (LRP), multidrug...Background and objective Neoadjuvant chemotherapy (NACT) plays an important role in systemic chemotherapy for non-small cell lung cancer (NSCLC). P-glycoprotein (P-gp), lung resistance related protein (LRP), multidrug resistance-associated protein (MRP) and glutathione S-transferase (GST-π) may be associated to drug resisitance to chemotherapy in NSCLC. The aim of this study is to investigate the expressions of P-gp, LRP, MRP and GST-π in samples from NSCLC patients before and after treatment with NACT, and their quantitative changes, so that to evaluate the influence of NACT on drug resistance to chemotherapy of NSCLC. Methods Total 92 specimens from 72 cases of NSCLC, including 52 samples of surgery excision from non-NACT-treated patients and 20 paired samples before and after NACT from the same patient, were studied. The expression of P-gp, LRP, MRP and GST-π was detected with tissue chip technique and immunohistochemistry. The quantitative analysis was carried out by computer image analysis system. Results In the samples before NACT, the positive rate of P-gp, LRP, MRP, GST-π expression was 66.67% (48/72), 72.22% (52/72), 81.94% (59/72), 83.33% (60/72), respectively. The expressive intensity of P-gp, LRP and GST-π was significantly stronger in adenocarcinoma than that in squamous cell carcinoma (P<0.05, P<0.001, P<0.001, respectively); there was no significant difference in the expression of MRP between adenocarcinoma and squamous cell carcinoma (P>0.05). In samples after treatment with NACT, the expression of P-gp, GST-π demonstrated by average optical density (AOD) and integral optical density (IOD) were significantly higher (P<0.05, P<0.001 respectively) than that in biopsied samples taken before NACT; The change in expression of P-gp, GST-π was also showed difference by different histopathological types, differentiations, ages, sizes, clinical stages as well as lymph node metastasis or not (P<0.05 or P<0.001). There was no significant difference between samples taken before and after NACT (P>0.05) in the expression of LRP and MRP demonstrated by both of AOD and IOD. Conclusion The results suggest that drug resistance in adenocarcinoma is primarily stronger than that in squamous cell carcinoma. NACT may enhance acquired drug resistance of NSCLC through inducing the expression of drug resistance protein. The results indicate that acquired drug resistance must be considered with the application of NACT to NSCLC patient in clinic, especially to patient in stage Ⅰ and Ⅱ. Since NACT may lead to the enhancement of acquired drug resistance in stage Ⅰ and Ⅱ, this may dwindle the therapeutic effect of chemotherapy after surgery. Comparative examination of drug resistance proteins before and after NACT, combining with comprehensive consideration of chemical regimens of NACT, should be recommended during chemotherapy of NSCLC for both before and after surgery.展开更多
Objective To evaluate the toxic effects and efficacy of the intra-arterial chrono-chemotherapy on patients with liver metastasis arised from colorectal cancer. Methods Chemotherapy of 42 patients were randomly divided...Objective To evaluate the toxic effects and efficacy of the intra-arterial chrono-chemotherapy on patients with liver metastasis arised from colorectal cancer. Methods Chemotherapy of 42 patients were randomly divided into group A (n = 20) with continuously constant arterial infusion, and group B (n = 22) with arterial chrono-modulated infusion. And the toxic effects and efficacy of two groups were compared. Results A significant difference was found in the toxic effects of digestive system between the two groups. The treatment response was similar in the two groups. Conclusions Intra-arterial chrono-chemotherapy may decrease the toxic effects and improve the life quality of these patients. (J Intervent Radiol, 2006, 15: 487-490)展开更多
基金The project supported by National Natural Science Foundation of China(81373828)
文摘OBJECTIVE To investigate the mechanisms of Xiaobanxia Tang(XBXT)in the prevention and treatment of chemotherapy-induced nausea and vomiting.METHODS The chemotherapy-induced rat pica model was established by intraperitoneal injection of cisplatin 6mg·kg-1.Kaolin consumption was used as an indicator of nausea and vomiting.Wistar male rats were randomly divided into normal control,XBXT normal control,model,ondansetron treating,XBXT decoction high and low dose groups.The rats in ondansetron group,XBXT normal control group,XBXT high and low dose groups were gavaged ondansetron 2.6mg·kg-1·d-1,XBXT 1.6,3.2and 1.6g·kg-1·d-1,respectively 1hbefore cisplatin injection,and the administration were given every 12 h.Kaolin consumptions were weighed every 12 h.After 24 hand 72hof cisplatin injection,animals were sacrificed respectively.The contents of 5-HT,5-HIAA,dopamine(DA),DOPAC,substance P(SP),TPH,MAO and TH were measured by ELISA.The mRNA expression of 5-HT transporter(SERT),5-HT3 Areceptor,SP precursor(PPTA),NK1 and D2receptors in rat ileum and medulla oblongata were measured by RT-PCR,the protein expression were measured by Western blotting.RESULTS The high and low dosages of XBXT could significantly inhibit kaolin consumptions in cisplatin-treated rats,and reduce5-HT,increase 5-HIAA contents and reduce 5-HT3 Areceptor mRNA and protein expression,above effects are related to the reduction of TPH and the enhancement of MAOA levels.The two dosages of XBXT could significantly reduce SP and NK1 mRNA and protein expression,which was related to the reduction of PPTA mRNA expression.XBXT could also significantly reduce DA contents and D2 receptor mRNA and protein expression,which was related to the reduction of TH.CONCLUSION XBXT has significant antiemetic effect in chemotherapy-induced nausea and vomiting,the underlying mechanisms are related to the inhibition of 5-HT and5-HT3 Areceptor,SP and NK1 receptor,DA and D2 receptor.
文摘Background and objective:Epidermal growth factor receptor(EGFR)mutations are often associated with non-EGFR genetic alterations,which maybe a reason for the poor efficacy of EGFR tyrosine kinase inhibitors(TKIs).Here we conducted this study to explore whether EGFR-TKIs combined with chemotherapy would benefit advanced lung adenocarcinoma patients with both sensitive EGFR mutation and concomitant non-EGFR genetic alterations.Materials and methods:Cases of advanced lung adenocarcinoma with EGFR mutation combined with concomitant nonEGFR genetic alterations were retrospectively collected.And the patients were required to receive first-line EGFR-TKIs and chemotherapy combination or EGFR-TKIs monotherapy.Demographic,clinical and pathological data were collected,and the electronic imaging data were retrieved to evaluate the efficacy and time of disease progression.Survival data were obtained through face-to-face or telephone follow-up.The differences between the two groups in objective response rate(ORR),disease control rate(DCR),progression-free survival(PFS)and overall survival(OS)were investigated.Results:107 patients were included,including 63 cases in the combination group and 44 cases in the monotherapy group.The ORR were 78%and 50%(P=0.003),and DCR were 97%and 77%(P=0.002),respectively.At a median follow-up of 13.7 mon,a PFS event occurred in 38.1%and 81.8%of patients in the two groups,with median PFS of18.8 mon and 5.3 mon,respectively(P<0.000,1).Median OS was unreached in the combination group,and 27.8 mon in the monotherapy group(P=0.31).According to the Cox multivariate regression analysis,combination therapy was an independent prognostic factor of PFS.Conclusion:In patients with EGFR-mutant advanced lung adenocarcinoma with concomitant non-EGFR genetic alterations,combination of TKIs and chemotherapy was significantly superior to EGFR-TKIs monotherapy,which should be the preferred treatment option.
文摘We present a rare challenging case of metastatic non-small cell lung cancer with Epstein-Barr virus positivity that was also diagnosed with pulmonary tuberculosis at the same time. Palliative chemotherapy gemcitabine and carboplatin was started after two weeks of anti-tuberculosis treatment with the hopes that this period would be sufficient to keep acid fast bacilli non-viable to minimise risk of tuberculosis re-activation due to chemotherapy induced immunosuppression. She completed four cycles of chemotherapy and six months of anti-tuberculosis treatment with good results and minimal side effects. Two years later, there was disease recurrence in cervical and mediastinal lymph nodes which was treated with local treatment i.e. surgery and palliative radiotherapy. It has been two years since last radiotherapy and overall more than five years since diagnosis with no active disease at present. Given the complexity and rarity of this case, significant multidisciplinary team involvement, including oncologists and radiation oncologists, pulmonologists with special interest in tuberculosis and pathologists was necessary throughout.
文摘Effects of fibroblast-mediated IL-2 and IL-3 genetherapy on recovery of bone marrow depression in tumor-bearing mice treated with cyclophosphamide (300 mg/kg) and syngeneic BMT were investigated in the presentreport. BALB/c mice were inoculated with J558Lplasmacytoma cells s. c. and 3 days later IL-2 secretingNIH3T3-IL-2, IL-3 secreting NIH3T3-IL-3 fibroblastcells were implanted into the tumor-bearing mice
文摘Antitumor chemotherapy is often limited by hematopoietic toxicity.TO attenuate themyelosuppressive effects of chemotherapy, successfulengraftment of unmodified fetal liver cells (FLCs) hasbeen achieved across allogeneic barriers in a number ofanimal models and patients, GM-CSF is a
文摘A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT （vincristine, 175 fold-resistancehigher than that in original KB cells） and ADM（adriamycin, 14. 5 fold） resulting over-expression ofMDRl. We used the primers for antisense RNA asfollowing: upstream 5′OGAATTCTGAAACCTGTAAGCAGCAACC 3′: downstream
文摘Background and objective Neoadjuvant chemotherapy (NACT) plays an important role in systemic chemotherapy for non-small cell lung cancer (NSCLC). P-glycoprotein (P-gp), lung resistance related protein (LRP), multidrug resistance-associated protein (MRP) and glutathione S-transferase (GST-π) may be associated to drug resisitance to chemotherapy in NSCLC. The aim of this study is to investigate the expressions of P-gp, LRP, MRP and GST-π in samples from NSCLC patients before and after treatment with NACT, and their quantitative changes, so that to evaluate the influence of NACT on drug resistance to chemotherapy of NSCLC. Methods Total 92 specimens from 72 cases of NSCLC, including 52 samples of surgery excision from non-NACT-treated patients and 20 paired samples before and after NACT from the same patient, were studied. The expression of P-gp, LRP, MRP and GST-π was detected with tissue chip technique and immunohistochemistry. The quantitative analysis was carried out by computer image analysis system. Results In the samples before NACT, the positive rate of P-gp, LRP, MRP, GST-π expression was 66.67% (48/72), 72.22% (52/72), 81.94% (59/72), 83.33% (60/72), respectively. The expressive intensity of P-gp, LRP and GST-π was significantly stronger in adenocarcinoma than that in squamous cell carcinoma (P<0.05, P<0.001, P<0.001, respectively); there was no significant difference in the expression of MRP between adenocarcinoma and squamous cell carcinoma (P>0.05). In samples after treatment with NACT, the expression of P-gp, GST-π demonstrated by average optical density (AOD) and integral optical density (IOD) were significantly higher (P<0.05, P<0.001 respectively) than that in biopsied samples taken before NACT; The change in expression of P-gp, GST-π was also showed difference by different histopathological types, differentiations, ages, sizes, clinical stages as well as lymph node metastasis or not (P<0.05 or P<0.001). There was no significant difference between samples taken before and after NACT (P>0.05) in the expression of LRP and MRP demonstrated by both of AOD and IOD. Conclusion The results suggest that drug resistance in adenocarcinoma is primarily stronger than that in squamous cell carcinoma. NACT may enhance acquired drug resistance of NSCLC through inducing the expression of drug resistance protein. The results indicate that acquired drug resistance must be considered with the application of NACT to NSCLC patient in clinic, especially to patient in stage Ⅰ and Ⅱ. Since NACT may lead to the enhancement of acquired drug resistance in stage Ⅰ and Ⅱ, this may dwindle the therapeutic effect of chemotherapy after surgery. Comparative examination of drug resistance proteins before and after NACT, combining with comprehensive consideration of chemical regimens of NACT, should be recommended during chemotherapy of NSCLC for both before and after surgery.
文摘Objective To evaluate the toxic effects and efficacy of the intra-arterial chrono-chemotherapy on patients with liver metastasis arised from colorectal cancer. Methods Chemotherapy of 42 patients were randomly divided into group A (n = 20) with continuously constant arterial infusion, and group B (n = 22) with arterial chrono-modulated infusion. And the toxic effects and efficacy of two groups were compared. Results A significant difference was found in the toxic effects of digestive system between the two groups. The treatment response was similar in the two groups. Conclusions Intra-arterial chrono-chemotherapy may decrease the toxic effects and improve the life quality of these patients. (J Intervent Radiol, 2006, 15: 487-490)
