Heat shock protein 90 (Hsp90) is a major heatshock protein whose functions are necessary for livingorganisms, including both procaryotes and eucaryotes.Human Hsp90 consists of two forms, Hsp90α andHsp90β. Expression...Heat shock protein 90 (Hsp90) is a major heatshock protein whose functions are necessary for livingorganisms, including both procaryotes and eucaryotes.Human Hsp90 consists of two forms, Hsp90α andHsp90β. Expression of Hsp90α appears to be inducible bydifferent stimuli. Adenovirus EIA gene products andtransformation with the H-ras oncogene can induce aselective overexpression of Hsp90α. Hsp90α was展开更多
The main component of the Center for Genetic Engineering and Biotechnology(CIGB)candidate vaccine against Hepatitis C virus(HCV)is the pIDKE2 plasmid.The current designed downstream process for the production of pIDKE...The main component of the Center for Genetic Engineering and Biotechnology(CIGB)candidate vaccine against Hepatitis C virus(HCV)is the pIDKE2 plasmid.The current designed downstream process for the production of pIDKE2 fulfils all regulatory requirements and renders the required quantities of pharmaceuticalgrade plasmid DNA(pDNA)with 95%purity.The advantages of this procedure include high plasmid purity and the elimination of undesirable additives,such as toxic organic extractants and animal-derived enzymes.However,yields and consequently the productivity of the process are low.Previous work demonstrated that the most critical step of the process is the reverse phase chromatography,where conventional porous particle resins are used.Therefore,to increase the process productivity,alternative technologies such as membranes and chromatographic monoliths were tested as alternative options for this critical step.Here,a comparison between the behaviors of CIM~ C4-HLD and Sartobind phenyl matrices was performed.To obtain higher productivities and purities,the dynamic binding capacities and selectivities were evaluated.The results showed that both matrices had a similar capacity for pIDKE2 plasmid,but the separation of pDNA isoforms using CIM~ technology was much better than that with Sartobind.Additionally,the optimal conditions for loading plasmid DNA on a CIMC4-HLD 800-mL monolithic column in a real production process were determined.These optimizations will allow production levels to satisfy the high plasmid consumption demanded by clinical trials.展开更多
Pulsed electric field has been used widely as a nonviral approach to improving gene delivery in basic and translational research[1-2].The technique has been called electrotransfection(ET),electroporation,electrogene t...Pulsed electric field has been used widely as a nonviral approach to improving gene delivery in basic and translational research[1-2].The technique has been called electrotransfection(ET),electroporation,electrogene transfer,and gene electroinjection in the literature [1,3].It has a great potential to improve clinical treatment of diseases through delivery of vaccines and therapeutic genes,genome and epigenome editing,and generation of human induced pluripotent stem cells for tissue engineering[1-3].During ET,extracellular transport of plasmid DNA(pDNA)relies on electrophoresis,which is critical for applications in vivo.However,mechanisms of intracellular transport remain to be understood.The lack of understanding has hindered the translation of ET technology to the clinic.It is well known that pulsed electric field can generate transient hydrophilic pores in the plasma membrane(i.e.,electroporation)that permit membrane-impermeant molecules to enter cells.Although the pores have yet to be visualized directly under a microscope,the electric field-induced membrane permeabilization has been demonstrated through experimental measurements of electrical conductance of synthetic lipid membranes and plasma membranes,direct observation of fluorescent markers crossing the membranes facing both cathode and anode,and numerical simulations of the membrane permeabilization[1,3].Results from the simulations have predicted that the cutoff size of the pores is on the order of a few hundred nanometers,and the lifetime of the pores that are larger than 100 nm is on the order of 10 msec.Although these data provide a solid evidence of the membrane permeabilization,recent studies have demonstrated that the generation of the pores is insufficient for ET[1,4].The reasons are as follows.First,the lifetime of the pores is several orders of magnitude shorter than the time scale for pDNA uptake,which is on the order of 10 min.Second,complex formation between pDNA and plasma membrane is a necessary condition for successful gene transfer.Third,inhibition of clathrin mediated endocytosis or Rac-1 dependent micropinocytosis can reduce the amount of pDNA internalized by cells [1].Finally,we demonstrate that few pDNA molecules can be observed in the cytosol that are not associated with the intracellular vesicles[5],suggesting that pDNA uptake is mediated by endocytosis.In addition to the internalization,ET requires the pDNA in the cytoplasm to reach the nucleus.To understand mechanisms of intracellular trafficking of pDNA,we have examined time-dependent pDNA distributions in cells,quantitatively determined percentages of pDNA molecules associated with different endocytic compartments using transmission electron microscopy(TEM),and investigated different approaches to facilitate cytoplasmic transport and nuclear entry of pDNA.Our data have shown that electrotransfected pDNA is located in different vesicular ultrastructures at or near the plasma membrane at10 min post application of electric pulses[5].In the hard-to-transfect cells(e.g.,4T1),pDNA penetration from the cell surface is less active,and the total number of vesicular structures associated with pDNA is low,compared to those in the easyto-transfect cells(e.g.,COS7).Our data have also shown that macropinocytosis is the most common pathway shared by all types of cells.To investigate how improve pDNA transport in cells,we have photochemically treated cells to non-specifically induce pDNA escape from intracellular vesicles,or blocked endosome and autophagic vacuole maturation through treatment of cells with Bafilomycin Al,an inhibitor of vacuolar H+ATPase.Our data demonstrate that both treatments can lead to reduction of ET efficiency although the treatment for inducing endosomal escape can enhance poly-L-lysine mediated gene delivery.These data suggest that the vesicles play an important role in protecting the naked pDNA during intracellular trafficking.The nuclear envelope is another major barrier to ET.To facilitate the nuclear entry,we have examined three different approaches.One is to synchronize the nuclear envelope breakdown(NEBD)prior to ET;the second approach is to pre-treat cells with a nuclear pore dilating agent(i.e.,trans-1,2-cyclohexanediol);and the third one is to incorporate a nuclear targeting sequence(NTS)(i.e.,SV40)into the pDNA.Our data have shown that the synchronization of the NEBD can significantly improve the ET efficiency without compromising the cell viability.The nuclear pore dilation can improve the ET as well but the dilating agent is cytotoxic.The incorporation of NTS into pDNA can improve the gene delivery efficiency but the improvement is cell-type dependent,suggesting that the NTS has to be screened and optimized for the cells of interest.In summary,the transient pores in the plasma membrane induced by the electric pulses will enable cellular uptake of membrane-impermeant molecules up to the size of small proteins.Larger molecules(e.g.,pDNA)have to be internalized via endocytic processes triggered by the pulsed electric field.Within the cells,pDNA transport is mediated by vesicles and can be blocked by non-specific escape from vesicles or inhibition of vesicle maturation.The nuclear entry of pDNA can be enhanced,without compromising cell viability,through the use of the NTS or the synchronization of the NEBD.展开更多
Factor Ⅷ deficiency or hemophilia A is X-linkedgenetic disorder in human. General treatment of severehemophilia A consists of adiministration of plasma-derived or recombinant clotting factor concentrates. Ithas cause...Factor Ⅷ deficiency or hemophilia A is X-linkedgenetic disorder in human. General treatment of severehemophilia A consists of adiministration of plasma-derived or recombinant clotting factor concentrates. Ithas caused a series of problems, i. e. viral infection andcost too much to use rF Ⅷ. Nowadays, people havedeveloped the retroviral vector and the adcnoviral展开更多
A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT （vincristine, 175 fold-resistancehigher than that in original KB cells） and ADM（...A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT （vincristine, 175 fold-resistancehigher than that in original KB cells） and ADM（adriamycin, 14. 5 fold） resulting over-expression ofMDRl. We used the primers for antisense RNA asfollowing: upstream 5′OGAATTCTGAAACCTGTAAGCAGCAACC 3′: downstream展开更多
To demonstrate that low c-myc expression mightexert the effects on differentiation and survival ofleukemic cells, antisense technique was used. Human 2. 7kb c-myc DNA fragment containing exon l, intron 1 and127nt exon...To demonstrate that low c-myc expression mightexert the effects on differentiation and survival ofleukemic cells, antisense technique was used. Human 2. 7kb c-myc DNA fragment containing exon l, intron 1 and127nt exon 2 was ligated into retroviral vector pDOR-neoin reverse direction. This recombinant plasmid展开更多
Liver tumours are among the most commonmalignancies worldwide. The international incidenceof the disease is about l million cases per year (male:femalc, 4: 1 ). These include primary and secondarytumours. Cancer is kn...Liver tumours are among the most commonmalignancies worldwide. The international incidenceof the disease is about l million cases per year (male:femalc, 4: 1 ). These include primary and secondarytumours. Cancer is known to be a genetic disease thatinvolves the alteration of activity of the products of atleast 2 genes, due to mutation (s) and/or otherfactors, e. g., the presence of viral oncoproteins. Thegenes most affected are the tumour suppressor展开更多
Objective: The objective of research is to explorethe prospective for direct gene transfer to be applied as aform of gene therapy. Materials and methods: ①Experimental animals: Male BALB/c mice, 0 - 8 weeksold;②Prep...Objective: The objective of research is to explorethe prospective for direct gene transfer to be applied as aform of gene therapy. Materials and methods: ①Experimental animals: Male BALB/c mice, 0 - 8 weeksold;②Preparations of plasmid: PCI-hIL-2 plasmid isexpression vector for human IL-2 containing cytome-galovirus immediate-early enhance/promoter region andT7 promoer;③Injection of plasmids: Male展开更多
BAC library for the Egyptian cotton Gossypiumbarbadense Giza 70,Giza 86,and Giza 75varieties have been constructed andcharacterized.The isolation and purification ofhigh molecular weight DNA from nucleiembedded in aga...BAC library for the Egyptian cotton Gossypiumbarbadense Giza 70,Giza 86,and Giza 75varieties have been constructed andcharacterized.The isolation and purification ofhigh molecular weight DNA from nucleiembedded in agarose microbeads was an essentialpart of this work.Several experimentalparameters were investigated展开更多
The purpose of this study was to evaluate the effect and the potential mechanism of administering a pGRF gene plasmid on the growth and immunological function of weanling piglets subjected to immune-stress.Eighteen we...The purpose of this study was to evaluate the effect and the potential mechanism of administering a pGRF gene plasmid on the growth and immunological function of weanling piglets subjected to immune-stress.Eighteen weanling(Duroc×Landrace×Large White) piglets aged 35 d±2 d and initial BW of 7.86 kg±0.59 kg were randomly assigned to three treatments according to gender and BW by using a single factor design.The three treatments were injections of a pGRF gene plasmid,pGRF gene plasmid followed by challenge with lipopolysaccharide(LPS),and LPS to piglets not receiving the plasmid.Each treatment group consisted of six piglets.The results were as follows:piglets in the pGRF gene plasmid plus LPS treatment had a better growth performance than those only receiving LPS(P【0.05), and F/G of piglets in the pGRF gene plasmid plus LPS group were very slightly lower(P】0.05) than those in the LPS group;serum levels of IGF-1 in the pGRF gene plasmid plus LPS group were significantly higher than those in the LPS group(P【0.05 or P【0.01);serum levels of IgG in the pGRF gene plasmid plus LPS group were higher than those in the LPS group(P【0.05);serum levels of IL-1 and IL-6 in the pGRF gene plasmid plus LPS group were significantly lower than those in the LPS group(P【0.05 or P【0.01).展开更多
An about 1.40 Kb target gene fragment was yielded by PCR amplification with the plasmid pRB 129,which was identified by restriction enzyme digestion that the PCR product was TUB2 gene.The gene was digested by the rest...An about 1.40 Kb target gene fragment was yielded by PCR amplification with the plasmid pRB 129,which was identified by restriction enzyme digestion that the PCR product was TUB2 gene.The gene was digested by the restriction enzyme and was linked with pTA plasmid to construct pTA TUB2 plasmid.The plasmid was transformed into Chaetomium spp.by PEG method and the transformation rate was 27/(2×10 5) and it is nine times higher than that of pRB 129.The transformants can grow on the PDA containing 1 000 μg·mL -1 carbendazim,which is 1 000 times higher than the original Chaetomium spp.The resistance was stable after 10 times transfer on non selective medium.展开更多
Plasmid DNA was irradiated or implanted by mixed particle field(CR) or lithium-ion-beam to detect strand breaks.The primary results showed that mixed particle field could induce single and double strand breaks with po...Plasmid DNA was irradiated or implanted by mixed particle field(CR) or lithium-ion-beam to detect strand breaks.The primary results showed that mixed particle field could induce single and double strand breaks with positive linear-dose-effects;most of sequence changes induced by CR were point mutant.Lithium-ion-beam could induce strand breaks also,but it was only at dose of 20Gy.展开更多
文摘Heat shock protein 90 (Hsp90) is a major heatshock protein whose functions are necessary for livingorganisms, including both procaryotes and eucaryotes.Human Hsp90 consists of two forms, Hsp90α andHsp90β. Expression of Hsp90α appears to be inducible bydifferent stimuli. Adenovirus EIA gene products andtransformation with the H-ras oncogene can induce aselective overexpression of Hsp90α. Hsp90α was
基金Center for Genetic Engineering and Biotechnology and BIA Separations Fund
文摘The main component of the Center for Genetic Engineering and Biotechnology(CIGB)candidate vaccine against Hepatitis C virus(HCV)is the pIDKE2 plasmid.The current designed downstream process for the production of pIDKE2 fulfils all regulatory requirements and renders the required quantities of pharmaceuticalgrade plasmid DNA(pDNA)with 95%purity.The advantages of this procedure include high plasmid purity and the elimination of undesirable additives,such as toxic organic extractants and animal-derived enzymes.However,yields and consequently the productivity of the process are low.Previous work demonstrated that the most critical step of the process is the reverse phase chromatography,where conventional porous particle resins are used.Therefore,to increase the process productivity,alternative technologies such as membranes and chromatographic monoliths were tested as alternative options for this critical step.Here,a comparison between the behaviors of CIM~ C4-HLD and Sartobind phenyl matrices was performed.To obtain higher productivities and purities,the dynamic binding capacities and selectivities were evaluated.The results showed that both matrices had a similar capacity for pIDKE2 plasmid,but the separation of pDNA isoforms using CIM~ technology was much better than that with Sartobind.Additionally,the optimal conditions for loading plasmid DNA on a CIMC4-HLD 800-mL monolithic column in a real production process were determined.These optimizations will allow production levels to satisfy the high plasmid consumption demanded by clinical trials.
基金supported by grants from National Institutes of Health ( GM098520 and GM130830)National Science Foundation ( CBET-1264186)
文摘Pulsed electric field has been used widely as a nonviral approach to improving gene delivery in basic and translational research[1-2].The technique has been called electrotransfection(ET),electroporation,electrogene transfer,and gene electroinjection in the literature [1,3].It has a great potential to improve clinical treatment of diseases through delivery of vaccines and therapeutic genes,genome and epigenome editing,and generation of human induced pluripotent stem cells for tissue engineering[1-3].During ET,extracellular transport of plasmid DNA(pDNA)relies on electrophoresis,which is critical for applications in vivo.However,mechanisms of intracellular transport remain to be understood.The lack of understanding has hindered the translation of ET technology to the clinic.It is well known that pulsed electric field can generate transient hydrophilic pores in the plasma membrane(i.e.,electroporation)that permit membrane-impermeant molecules to enter cells.Although the pores have yet to be visualized directly under a microscope,the electric field-induced membrane permeabilization has been demonstrated through experimental measurements of electrical conductance of synthetic lipid membranes and plasma membranes,direct observation of fluorescent markers crossing the membranes facing both cathode and anode,and numerical simulations of the membrane permeabilization[1,3].Results from the simulations have predicted that the cutoff size of the pores is on the order of a few hundred nanometers,and the lifetime of the pores that are larger than 100 nm is on the order of 10 msec.Although these data provide a solid evidence of the membrane permeabilization,recent studies have demonstrated that the generation of the pores is insufficient for ET[1,4].The reasons are as follows.First,the lifetime of the pores is several orders of magnitude shorter than the time scale for pDNA uptake,which is on the order of 10 min.Second,complex formation between pDNA and plasma membrane is a necessary condition for successful gene transfer.Third,inhibition of clathrin mediated endocytosis or Rac-1 dependent micropinocytosis can reduce the amount of pDNA internalized by cells [1].Finally,we demonstrate that few pDNA molecules can be observed in the cytosol that are not associated with the intracellular vesicles[5],suggesting that pDNA uptake is mediated by endocytosis.In addition to the internalization,ET requires the pDNA in the cytoplasm to reach the nucleus.To understand mechanisms of intracellular trafficking of pDNA,we have examined time-dependent pDNA distributions in cells,quantitatively determined percentages of pDNA molecules associated with different endocytic compartments using transmission electron microscopy(TEM),and investigated different approaches to facilitate cytoplasmic transport and nuclear entry of pDNA.Our data have shown that electrotransfected pDNA is located in different vesicular ultrastructures at or near the plasma membrane at10 min post application of electric pulses[5].In the hard-to-transfect cells(e.g.,4T1),pDNA penetration from the cell surface is less active,and the total number of vesicular structures associated with pDNA is low,compared to those in the easyto-transfect cells(e.g.,COS7).Our data have also shown that macropinocytosis is the most common pathway shared by all types of cells.To investigate how improve pDNA transport in cells,we have photochemically treated cells to non-specifically induce pDNA escape from intracellular vesicles,or blocked endosome and autophagic vacuole maturation through treatment of cells with Bafilomycin Al,an inhibitor of vacuolar H+ATPase.Our data demonstrate that both treatments can lead to reduction of ET efficiency although the treatment for inducing endosomal escape can enhance poly-L-lysine mediated gene delivery.These data suggest that the vesicles play an important role in protecting the naked pDNA during intracellular trafficking.The nuclear envelope is another major barrier to ET.To facilitate the nuclear entry,we have examined three different approaches.One is to synchronize the nuclear envelope breakdown(NEBD)prior to ET;the second approach is to pre-treat cells with a nuclear pore dilating agent(i.e.,trans-1,2-cyclohexanediol);and the third one is to incorporate a nuclear targeting sequence(NTS)(i.e.,SV40)into the pDNA.Our data have shown that the synchronization of the NEBD can significantly improve the ET efficiency without compromising the cell viability.The nuclear pore dilation can improve the ET as well but the dilating agent is cytotoxic.The incorporation of NTS into pDNA can improve the gene delivery efficiency but the improvement is cell-type dependent,suggesting that the NTS has to be screened and optimized for the cells of interest.In summary,the transient pores in the plasma membrane induced by the electric pulses will enable cellular uptake of membrane-impermeant molecules up to the size of small proteins.Larger molecules(e.g.,pDNA)have to be internalized via endocytic processes triggered by the pulsed electric field.Within the cells,pDNA transport is mediated by vesicles and can be blocked by non-specific escape from vesicles or inhibition of vesicle maturation.The nuclear entry of pDNA can be enhanced,without compromising cell viability,through the use of the NTS or the synchronization of the NEBD.
文摘Factor Ⅷ deficiency or hemophilia A is X-linkedgenetic disorder in human. General treatment of severehemophilia A consists of adiministration of plasma-derived or recombinant clotting factor concentrates. Ithas caused a series of problems, i. e. viral infection andcost too much to use rF Ⅷ. Nowadays, people havedeveloped the retroviral vector and the adcnoviral
文摘A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT （vincristine, 175 fold-resistancehigher than that in original KB cells） and ADM（adriamycin, 14. 5 fold） resulting over-expression ofMDRl. We used the primers for antisense RNA asfollowing: upstream 5′OGAATTCTGAAACCTGTAAGCAGCAACC 3′: downstream
文摘To demonstrate that low c-myc expression mightexert the effects on differentiation and survival ofleukemic cells, antisense technique was used. Human 2. 7kb c-myc DNA fragment containing exon l, intron 1 and127nt exon 2 was ligated into retroviral vector pDOR-neoin reverse direction. This recombinant plasmid
文摘Liver tumours are among the most commonmalignancies worldwide. The international incidenceof the disease is about l million cases per year (male:femalc, 4: 1 ). These include primary and secondarytumours. Cancer is known to be a genetic disease thatinvolves the alteration of activity of the products of atleast 2 genes, due to mutation (s) and/or otherfactors, e. g., the presence of viral oncoproteins. Thegenes most affected are the tumour suppressor
文摘Objective: The objective of research is to explorethe prospective for direct gene transfer to be applied as aform of gene therapy. Materials and methods: ①Experimental animals: Male BALB/c mice, 0 - 8 weeksold;②Preparations of plasmid: PCI-hIL-2 plasmid isexpression vector for human IL-2 containing cytome-galovirus immediate-early enhance/promoter region andT7 promoer;③Injection of plasmids: Male
文摘BAC library for the Egyptian cotton Gossypiumbarbadense Giza 70,Giza 86,and Giza 75varieties have been constructed andcharacterized.The isolation and purification ofhigh molecular weight DNA from nucleiembedded in agarose microbeads was an essentialpart of this work.Several experimentalparameters were investigated
文摘The purpose of this study was to evaluate the effect and the potential mechanism of administering a pGRF gene plasmid on the growth and immunological function of weanling piglets subjected to immune-stress.Eighteen weanling(Duroc×Landrace×Large White) piglets aged 35 d±2 d and initial BW of 7.86 kg±0.59 kg were randomly assigned to three treatments according to gender and BW by using a single factor design.The three treatments were injections of a pGRF gene plasmid,pGRF gene plasmid followed by challenge with lipopolysaccharide(LPS),and LPS to piglets not receiving the plasmid.Each treatment group consisted of six piglets.The results were as follows:piglets in the pGRF gene plasmid plus LPS treatment had a better growth performance than those only receiving LPS(P【0.05), and F/G of piglets in the pGRF gene plasmid plus LPS group were very slightly lower(P】0.05) than those in the LPS group;serum levels of IGF-1 in the pGRF gene plasmid plus LPS group were significantly higher than those in the LPS group(P【0.05 or P【0.01);serum levels of IgG in the pGRF gene plasmid plus LPS group were higher than those in the LPS group(P【0.05);serum levels of IL-1 and IL-6 in the pGRF gene plasmid plus LPS group were significantly lower than those in the LPS group(P【0.05 or P【0.01).
基金Heilongjiang Province Natural Science fund( Grant No.C0 2 0 3 )
文摘An about 1.40 Kb target gene fragment was yielded by PCR amplification with the plasmid pRB 129,which was identified by restriction enzyme digestion that the PCR product was TUB2 gene.The gene was digested by the restriction enzyme and was linked with pTA plasmid to construct pTA TUB2 plasmid.The plasmid was transformed into Chaetomium spp.by PEG method and the transformation rate was 27/(2×10 5) and it is nine times higher than that of pRB 129.The transformants can grow on the PDA containing 1 000 μg·mL -1 carbendazim,which is 1 000 times higher than the original Chaetomium spp.The resistance was stable after 10 times transfer on non selective medium.
文摘Plasmid DNA was irradiated or implanted by mixed particle field(CR) or lithium-ion-beam to detect strand breaks.The primary results showed that mixed particle field could induce single and double strand breaks with positive linear-dose-effects;most of sequence changes induced by CR were point mutant.Lithium-ion-beam could induce strand breaks also,but it was only at dose of 20Gy.
