Mitigation effects of coenzyme Q10(CoQ10)on spiromesifen(SPM)-induced acute toxicity to zebrafish at different life stages,as well as abnormal development,especially impaired development of heart and notochord,oxidati...Mitigation effects of coenzyme Q10(CoQ10)on spiromesifen(SPM)-induced acute toxicity to zebrafish at different life stages,as well as abnormal development,especially impaired development of heart and notochord,oxidative stress and apoptosis in embryos were investigated using a semi-static method.Results showed that CoQ10 can remarkably reduce the acute toxicity of SPM to zebrafish embryos,larvae and adults by 3.20-,2.09-and 1.51-fold,respectively.CoQ10 can effectively alleviate the SPM-induced abnormal spontaneous movement,decreased heartbeat,delayed hatching,growth inhibition and various teratogenic effects of zebrafish embryos.At the stage of zebrafish embryo,CoQ10 significantly increases superoxide dismutase(SOD)activity and expression levels of genes related to anti-oxidation(Cat&Cu/Zn-sod),anti-apoptosis(mcl1a&mcl1b),heart development(cmlc1,actc1a&erbb4a)and angiogenesis(vegfaa,vegfd&kdrl),which are inhibited by SPM.Additionally,CoQ10 reduces malondialdehyde(MDA)content and caspase-3 activity of embryos,as well as expression levels of pro-apoptosis(Cas3,Cas9,P53&bax)and notochord(tbxta&col2a)related genes raised by SPM.The results indicate that CoQ10 can mitigate the acute toxicity of SPM to zebrafish,and alleviate the abnormal development of heart and notochord of embryos by reducing oxidative stress and apoptosis,as well as regulating the expression of related genes.展开更多
Developmental and reproductive toxicity(DART)endpoint entails a toxicological assessment of all developmental stages and reproductive cycles of an organism.In silico tools to predict DART will provide a method to asse...Developmental and reproductive toxicity(DART)endpoint entails a toxicological assessment of all developmental stages and reproductive cycles of an organism.In silico tools to predict DART will provide a method to assess this complex toxicity endpoint and will be valuable for screening emerging pollutants as well as for m anaging new chemicals in China.Currently,there are few published DART prediction models in China,but many related research and development projects are in progress.In 2013,WU et al.published an expert rule-based DART decision tree(DT).This DT relies on known chemical structures linked to DART to forecast DART potential of a given chemical.Within this procedure,an accurate DART data interpretation is the foundation of building and expanding the DT.This paper excerpted case studies demonstrating DART data curation and interpretation of four chemicals(including 8-hydroxyquinoline,3,5,6-trichloro-2-pyridinol,thiacloprid,and imidacloprid)to expand the existing DART DT.Chemicals were first selected from the database of Solid Waste and Chemicals Management Center,Ministry of Ecology and Environment(MEESCC)in China.The structures of these 4 chemicals were analyzed and preliminarily grouped by chemists based on core structural features,functional groups,receptor binding property,metabolism,and possible mode of actions.Then,the DART conclusion was derived by collecting chemical information,searching,integrating,and interpreting DART data by the toxicologists.Finally,these chemicals were classified into either an existing category or a new category via integrating their chemical features,DART conclusions,and biological properties.The results showed that 8-hydroxyquinoline impacted estrous cyclicity,s exual organ weights,and embryonal development,and 3,5,6-trichloro-2-pyridinol caused central nervous system(CNS)malformations,which were added to an existing subcategory 8e(aromatic compounds with multi-halogen and nitro groups)of the DT.Thiacloprid caused dystocia and fetal skeletal malformation,and imidacloprid disrupted the endocrine system and male fertility.They both contain 2-chloro-5-methylpyridine substituted imidazolidine c yclic ring,which were expected to create a new category of neonicotinoids.The current work delineates a t ransparent process of curating toxicological data for the purpose of DART data interpretation.In the presence of sufficient related structures and DART data,the DT can be expanded by iteratively adding chemicals within the a pplicable domain of each category or subcategory.This DT can potentially serve as a tool for screening emerging pollutants and assessing new chemicals in China.展开更多
Zearalenone(ZEN)is a non-steroidal estrogenic mycotoxin biosynthesized by the polyketide reaction,which has estrogenic effects and triggers toxic effects,such as reproductive toxicity,hepatotoxicity,genotoxicity,and i...Zearalenone(ZEN)is a non-steroidal estrogenic mycotoxin biosynthesized by the polyketide reaction,which has estrogenic effects and triggers toxic effects,such as reproductive toxicity,hepatotoxicity,genotoxicity,and immunotoxicity in organism.Due to its impact on human and animal health and the economic losses engendered by ZEN,detoxification strategies for contaminated foods and feeds to reduce or eliminate the toxic effects of ZEN by chemical,physical and biological methods are crucial.Detoxification by microbial means has broad application prospects,with the advantages of high efficiency,high specificity,mild conditions of action,no harmful metabolites,and safety.It may help to improve the function of intestinal barriers so that the intestinal epithelial barrier is more resistant to mycotoxins,and other pathogenic microorganisms.This article provided an overview of the metabolic pathways and animal toxicity of ZEN in organism,and summarized the effects of the current research status,detoxification mechanisms and in vivo applications of ZEN biodetoxification,in order to provide a reference for the prevention and control of ZEN.展开更多
The N-GAS model for predicting smoke toxicity has been proposed for many years by NIST.However,almost all the existing CFD software cannot accurately predict the toxicity of smoke using the model because of the absenc...The N-GAS model for predicting smoke toxicity has been proposed for many years by NIST.However,almost all the existing CFD software cannot accurately predict the toxicity of smoke using the model because of the absence of the toxic gas concentration of HCN,NO x,HCl and HBr.In this work,an approach for predicting fire smoke toxicity was developed and demonstrated.A detailed mechanism including these fire effluents was constructed firstly,and the subsequent generation of state relationship among fire effluents,mixture fraction and strain rate was conducted by using opposed-flow flame technique.A mixture fraction-based combustion model used in FDS code was modified,and meanwhile the scalar dissipation rate transport equation was numerically solved.Thus the concentration of fire effluents as the function of mixture fraction and scalar dissipation rate can be calculated through a look-up table,and the toxic potency based on the 7-gas model can be obtained.The method was applied into an underground commercial street in Chongqing.It showed that the results between the 7-gas model and 3-gas model(CO,CO 2,and O 2) were obviously different.It indicated that there needs some modifications in conclusions and results from 3-gas model for fire-risk assessments.展开更多
A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT (vincristine, 175 fold-resistancehigher than that in original KB cells) and ADM(...A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT (vincristine, 175 fold-resistancehigher than that in original KB cells) and ADM(adriamycin, 14. 5 fold) resulting over-expression ofMDRl. We used the primers for antisense RNA asfollowing: upstream 5′OGAATTCTGAAACCTGTAAGCAGCAACC 3′: downstream展开更多
Effects of copper toxicity and salinity shock on selective group of juvenile pompano Trachinotus ovatus were investigated.The fish were exposed to different Cu2+ concentrations of 0(blank),0.02(C1),0.05(C2),0.10(C3),a...Effects of copper toxicity and salinity shock on selective group of juvenile pompano Trachinotus ovatus were investigated.The fish were exposed to different Cu2+ concentrations of 0(blank),0.02(C1),0.05(C2),0.10(C3),and 0.15 mg·L–1(C4)at a salinity of 10‰ or 40‰ for 96 h,with the salinity of 29‰ as the control.The results showed that the effects of the acute salinity stimulation to survival rates of pompano between control(29‰)and lower or higher salinity for 96 h were not significant(p>0.05).However,the survival rates in each treatment were decreased with the increase of Cu2+ concentration.The dominant factor influencing body moisture of the fish was salinity,and there was no sign that body moisture was correlated with exposure to Cu2+.The gill lamellas in high level of Cu2+ concentration(C4 treatments)were abnormal under the salinity of 40‰ and extremely curly under the salinity of 10‰.Hemorrhage in gill was observed in the two C4 treatments.Under transmission electron microscope,pillar cells in gill lamellas appeared deformed and ruptured in some areas of the epithelia in the higher concentration of Cu2+,resulting in the death of the fish due to the destruction of gill tissue,elevation of the arithmetic mean distance from water to blood,the decrease of oxygen diffusion capacity,and other physiological functions.These findings indicate that the pompano might suffer much more pressure when encountered with Cu2+ pollution and low salinity.展开更多
OBJECTIVE Vanadium is a necessary trace element in the human body and has a certain role in the treatment and prevention of diabetes.Organic vanadium is more easily absorbed and less toxic than inorganic vanadium.Thus...OBJECTIVE Vanadium is a necessary trace element in the human body and has a certain role in the treatment and prevention of diabetes.Organic vanadium is more easily absorbed and less toxic than inorganic vanadium.Thus,in this study,vanadium complex was synthesized from genistein which had good hypoglycemic activity and inor⁃ganic vanadium element,and its hypoglycemic activity and acute oral toxicity were studied.METHODS The vanadium genistein complex was synthesized by chelating vanadium with genistein in methanol and its structure was determined by LC-MS,atomic absorption spectroscopy,UV-visible spectroscopy,elemental and thermodynamic analysis.The antidiabetic activity of the complex was assessed in db/db mice and C57 mice by daily oral gavage for 4 weeks.These db/db mice were divided into test groups〔high(30 mg·kg^-1),medium(20 mg·kg^-1)and low(10 mg·kg^-1)dose group〕,model group,genistein group,inorganic vanadium group,each group of 8;8 C57 mice was for normal control group.The acute toxicity test was carried out on KM mice with this complex by a maximum limit dose method.Randomly 20 healthy KM mice were divided into negative control group and test group,each group of 10,male and female half.RESULTS The molecular structure of this complex was inferred as a complex(VL2)formed by two ligands and one vanadium element.It was found that its hypoglycemic activity was better than that of genistein and inorganic vanadium.The hypoglycemic activity of the high dose group was better than that of the medium dose group and low dose group.The complex can signifi⁃cantly improve the body mass of db/db mice,fasting blood glucose,random blood glucose,liver/body,kidney/body,and the performance of oral glucose tolerance test and insulin tolerance test in db/db mice.The morphology of liver,kidney,pancreas and skeletal muscle also had obvious improvement and repair.Effect on serum index of db/db mice showed that,total cholesterol,triglyceride,low-density lipoprotein cholesterol had no significant improvement compared with the model group,but high-density lipoprotein cholesterol of complex group had significant improvement compared with the model group.In addition,this complex did not produce any hazardous symptoms or deaths in acute oral toxicity test.CONCLUSION complex has good hypoglycemic activity in vivo,and did not have the potential toxicity.This would provide an important reference for the development of functional hypoglycemic foods.展开更多
In order to evaluate the toxicity of the bisphenol A (BPA) on the growth of zebrafish embryos, fertilized eggs were exposed to the concentration of 2.00, 4.00, 6.00, 8.00, 10.00, 15.00, 18.00, 22.00 and 25.00mg/L BPA ...In order to evaluate the toxicity of the bisphenol A (BPA) on the growth of zebrafish embryos, fertilized eggs were exposed to the concentration of 2.00, 4.00, 6.00, 8.00, 10.00, 15.00, 18.00, 22.00 and 25.00mg/L BPA for 72 h at 26±1℃. The results revealed that the sublethal toxicological endpoints induced by BPA were:delayed hatch> blood balk >cyst>altered axial curvature and tail malformation. The median embryo lethal concentration (LC50) after 24 h was 16.36 mg/L. We concluded that the BPA toxicity on zebrafish embryos were caused before 8h exposure and it was not the result of long-term accumulation. Therefore, BPA maybe cause altered gene expression at the early stage of zebrafish embryos. In the further studies, we will use the technology of genetic chips to look for the toxic mechanism of BPA.展开更多
LY-04 and WSQIF are newly-synthesized compounds which were presented by the Institute of Pesticides Chemistry, Central China Normal University. LY-04 belongs to α-oxophosphonic acid derivatives, while WSQIF is an aro...LY-04 and WSQIF are newly-synthesized compounds which were presented by the Institute of Pesticides Chemistry, Central China Normal University. LY-04 belongs to α-oxophosphonic acid derivatives, while WSQIF is an aromatic acetyl oxophosphonic acid derivative. In this study, the toxicity of LY-04 and WSQIF on Scenedesmus obliquus Kütz was examined. The EC 50 of LY-04 and WSQIF were determined in S. obliquus cells at 24h, 48h, 72h, 96h represented by cell density. Our data showed that the 24h, 48h, 72h, 96h EC 50 of LY-04 were 1983mg/L, 2943mg/L, 240mg/L and 65.0mg/L acetone, respectively, and the 24h, 48h, 72h, 96h EC 50 of WSQIF were 15.9mg/L, 53.0mg/L, 98.0mg/L and 28.8mg/L respectively. LY-04 displayed a higher insecticidal activity, while WSQIF showed a higher phytocidal activity. As LY-04 and WSQIF were designed to act as insecticide and herbicide, respectively, the results were in contrast to the anticipated ones. According to the toxicant classification standard, EC 50 of both substances was far higher than 3mg/L, while the toxicity of LY-04 and WSQIF to aquatic algae were fairly low, indicating that these two pesticides are rather safe to the aquatic ecosystem.展开更多
Persistent perfluorinated organic compounds, such as perfluorooctane sulfonate (PFOS) and perfluorooctanoate (PFOA) are used in a variety of industrial applications. They are very stable in the environment, distribute...Persistent perfluorinated organic compounds, such as perfluorooctane sulfonate (PFOS) and perfluorooctanoate (PFOA) are used in a variety of industrial applications. They are very stable in the environment, distribute widely in the global environment and in wild life, and are detected in human sera. Our searches have detected ppt levels of PFOS and PFOA in the surface water of Japan and China; their levels are generally more than ten times higher in city areas. Neither PFOS nor PFOA is removed by the purification process of city water. Both PFOS and PFOA are detected in sera of all the people of Japan and China (about 1000 times as high as those in surface water), and their concentrations are increasing in both countries, especially in China. PFOS and PFOA primarily distribute to the liver and cause the liver toxicity. They also cause developmental toxicity. PFOS which is not genotoxic in a variety of assay system including our in vivo comet assay, induced tumors of the liver, thyroid and mammary gland of rats. PFOA which is weakly carcinogenic is not mutagenic in many studies including our in vivo comet assay.展开更多
In order to evaluate the toxicity of compound planks in ships exposed to room and high temperature and provide the scientific basis for correct and rational screening of these materials,the room temperature released p...In order to evaluate the toxicity of compound planks in ships exposed to room and high temperature and provide the scientific basis for correct and rational screening of these materials,the room temperature released products and high-temperature decomposed products of 2 kinds of compound planks were analyzed quantitatively by GC-MS technique.展开更多
In order to evaluate the toxicity of adhesive in ships exposed to room and high temperature and provide the scientific basis for correct and rational screening of these materials,the room temperature released products...In order to evaluate the toxicity of adhesive in ships exposed to room and high temperature and provide the scientific basis for correct and rational screening of these materials,the room temperature released products and high-temperature decomposed products of 3 kinds of special adhesive were analyzed quantitatively by GC-MS technique.展开更多
The spectrum user’s librarys containing 1533 familiar toxicants have been built; A method with high separability and sensitivity has been found,The RT and the detection limit of 210 familiar abuse drugs has been conf...The spectrum user’s librarys containing 1533 familiar toxicants have been built; A method with high separability and sensitivity has been found,The RT and the detection limit of 210 familiar abuse drugs has been confirmed; the processing methods to analyse spectrum data automatically have been found; It is simple,quick,sensitive and reliable,and can take place of manual operation,It is very useful to screen the familiar toxicants in unkown sample.展开更多
A series of batch experiments were conducted in 125 mL serum bottles to assess the toxicity of different concentrations of ammonia nitrogen to the specific methanogenic activity of anaerobic granular sludge from upflo...A series of batch experiments were conducted in 125 mL serum bottles to assess the toxicity of different concentrations of ammonia nitrogen to the specific methanogenic activity of anaerobic granular sludge from upflow anaerobic sludge bed(UASB) and expanded granular sludge bed(EGSB) reactors. The effects of pH value and temperature on toxicity of ammonia nitrogen to anaerobes were investigated. The results show that the specific methanogenic activity of anaerobic granular sludge suffers inhibition from ammonia nitrogen, the concentrations of ammonia nitrogen that produce 50 % inhibition of specific methanogenic activity for sludge from UASB and EGSB reactor are 2.35 and 2.75 g/L, respectively. Hydrogen utilizing methanogens suffers less inhibition from ammonia mtrogen than that of acetate utilizing methanogens. Hydrogen-producing acetogens that utilize propionate and butyrate as substrates suffer serious inhibition from ammonia nitrogen. The toxicity of ammonia nitrogen to anaerobic granular sludge enhances when pH value and temperature increase. Anaerobic granular sludge can bear higher concentrations of ammonia nitrogen after being acclimated by ammonia nitrogen for 7 d.展开更多
The long-term storage of phosphate tailings will occupy a large amount of land,pollute soil and groundwater,thus,it is crucial to achieve the harmless disposal of phosphate tailings.In this study,high-performance geop...The long-term storage of phosphate tailings will occupy a large amount of land,pollute soil and groundwater,thus,it is crucial to achieve the harmless disposal of phosphate tailings.In this study,high-performance geopolymers with compressive strength of 38.8 MPa were prepared by using phosphate tailings as the main raw material,fly ash as the active silicon-aluminum material,and water glass as the alkaline activator.The solid content of phosphate tailings and fly ash was 60%and 40%,respectively,and the water-cement ratio was 0.22.The results of XRD,FTIR,SEM-EDS and XPS show that the reactivity of phosphate tailings with alkaline activator is weak,and the silicon-aluminum material can react with alkaline activator to form zeolite and gel,and encapsulate/cover the phosphate tailings to form a dense phosphate tailings-based geopolymer.During the formation of geopolymers,part of the aluminum-oxygen tetrahedron replaced the silicon-oxygen tetrahedron,causing the polycondensation reaction between geopolymers and increasing the strength of geopolymers.The leaching toxicity test results show that the geopolymer has a good solid sealing effect on heavy metal ions.The preparation of geopolymer from phosphate tailings is an important way to alleviate the storage pressure and realize the resource utilization of phosphate tailings.展开更多
The concentration of heavy metals was investigated in black soil samples collected from the fields treated with chemical in Bayan County which were from the vegetation covers,bare soil and grain fields without any che...The concentration of heavy metals was investigated in black soil samples collected from the fields treated with chemical in Bayan County which were from the vegetation covers,bare soil and grain fields without any chemical treatments in Hailun National Field Research Station of Agroecosystem,Chinese Academy of Sciences (CAS) in July,2009.Results showed that the presence of significantly high concentration of zinc (Zn) and lead (Pb) in soils covered with grass vegetation.However,mercury (Hg),copper (Cu),nick...展开更多
Atrazine (ATR) and chlorpyrifos (CPF) are widely used in agriculture, but have resulted in a series of toxicological and environmental problems. They were heavily used which have potential threat to fish and roden...Atrazine (ATR) and chlorpyrifos (CPF) are widely used in agriculture, but have resulted in a series of toxicological and environmental problems. They were heavily used which have potential threat to fish and rodents. Several recent laboratory studies have shown ATR and CPF could lead to oxidative damage, immunocyte reduced and inhibit acetylcholinesterase (ACHE). In order to clarify the toxicity of ATR and CPF, this paper summarized the adverse effects of ATR and CPF on reproduction, nerve and immune systems in fish.展开更多
基金Supported by National Key Research and Development Program of China(No.2017YFD0200504)。
文摘Mitigation effects of coenzyme Q10(CoQ10)on spiromesifen(SPM)-induced acute toxicity to zebrafish at different life stages,as well as abnormal development,especially impaired development of heart and notochord,oxidative stress and apoptosis in embryos were investigated using a semi-static method.Results showed that CoQ10 can remarkably reduce the acute toxicity of SPM to zebrafish embryos,larvae and adults by 3.20-,2.09-and 1.51-fold,respectively.CoQ10 can effectively alleviate the SPM-induced abnormal spontaneous movement,decreased heartbeat,delayed hatching,growth inhibition and various teratogenic effects of zebrafish embryos.At the stage of zebrafish embryo,CoQ10 significantly increases superoxide dismutase(SOD)activity and expression levels of genes related to anti-oxidation(Cat&Cu/Zn-sod),anti-apoptosis(mcl1a&mcl1b),heart development(cmlc1,actc1a&erbb4a)and angiogenesis(vegfaa,vegfd&kdrl),which are inhibited by SPM.Additionally,CoQ10 reduces malondialdehyde(MDA)content and caspase-3 activity of embryos,as well as expression levels of pro-apoptosis(Cas3,Cas9,P53&bax)and notochord(tbxta&col2a)related genes raised by SPM.The results indicate that CoQ10 can mitigate the acute toxicity of SPM to zebrafish,and alleviate the abnormal development of heart and notochord of embryos by reducing oxidative stress and apoptosis,as well as regulating the expression of related genes.
文摘Developmental and reproductive toxicity(DART)endpoint entails a toxicological assessment of all developmental stages and reproductive cycles of an organism.In silico tools to predict DART will provide a method to assess this complex toxicity endpoint and will be valuable for screening emerging pollutants as well as for m anaging new chemicals in China.Currently,there are few published DART prediction models in China,but many related research and development projects are in progress.In 2013,WU et al.published an expert rule-based DART decision tree(DT).This DT relies on known chemical structures linked to DART to forecast DART potential of a given chemical.Within this procedure,an accurate DART data interpretation is the foundation of building and expanding the DT.This paper excerpted case studies demonstrating DART data curation and interpretation of four chemicals(including 8-hydroxyquinoline,3,5,6-trichloro-2-pyridinol,thiacloprid,and imidacloprid)to expand the existing DART DT.Chemicals were first selected from the database of Solid Waste and Chemicals Management Center,Ministry of Ecology and Environment(MEESCC)in China.The structures of these 4 chemicals were analyzed and preliminarily grouped by chemists based on core structural features,functional groups,receptor binding property,metabolism,and possible mode of actions.Then,the DART conclusion was derived by collecting chemical information,searching,integrating,and interpreting DART data by the toxicologists.Finally,these chemicals were classified into either an existing category or a new category via integrating their chemical features,DART conclusions,and biological properties.The results showed that 8-hydroxyquinoline impacted estrous cyclicity,s exual organ weights,and embryonal development,and 3,5,6-trichloro-2-pyridinol caused central nervous system(CNS)malformations,which were added to an existing subcategory 8e(aromatic compounds with multi-halogen and nitro groups)of the DT.Thiacloprid caused dystocia and fetal skeletal malformation,and imidacloprid disrupted the endocrine system and male fertility.They both contain 2-chloro-5-methylpyridine substituted imidazolidine c yclic ring,which were expected to create a new category of neonicotinoids.The current work delineates a t ransparent process of curating toxicological data for the purpose of DART data interpretation.In the presence of sufficient related structures and DART data,the DT can be expanded by iteratively adding chemicals within the a pplicable domain of each category or subcategory.This DT can potentially serve as a tool for screening emerging pollutants and assessing new chemicals in China.
基金Supported by China Agriculture Research System(CARS-35)the Natural Science Foundation of Heilongjiang Province of China(LH2021C038)。
文摘Zearalenone(ZEN)is a non-steroidal estrogenic mycotoxin biosynthesized by the polyketide reaction,which has estrogenic effects and triggers toxic effects,such as reproductive toxicity,hepatotoxicity,genotoxicity,and immunotoxicity in organism.Due to its impact on human and animal health and the economic losses engendered by ZEN,detoxification strategies for contaminated foods and feeds to reduce or eliminate the toxic effects of ZEN by chemical,physical and biological methods are crucial.Detoxification by microbial means has broad application prospects,with the advantages of high efficiency,high specificity,mild conditions of action,no harmful metabolites,and safety.It may help to improve the function of intestinal barriers so that the intestinal epithelial barrier is more resistant to mycotoxins,and other pathogenic microorganisms.This article provided an overview of the metabolic pathways and animal toxicity of ZEN in organism,and summarized the effects of the current research status,detoxification mechanisms and in vivo applications of ZEN biodetoxification,in order to provide a reference for the prevention and control of ZEN.
基金sponsored by National Natural Science Foundation of China(No.50676091,No.50876097)Program for New Century Excellent Talents in University of China(NCET-06-0546)
文摘The N-GAS model for predicting smoke toxicity has been proposed for many years by NIST.However,almost all the existing CFD software cannot accurately predict the toxicity of smoke using the model because of the absence of the toxic gas concentration of HCN,NO x,HCl and HBr.In this work,an approach for predicting fire smoke toxicity was developed and demonstrated.A detailed mechanism including these fire effluents was constructed firstly,and the subsequent generation of state relationship among fire effluents,mixture fraction and strain rate was conducted by using opposed-flow flame technique.A mixture fraction-based combustion model used in FDS code was modified,and meanwhile the scalar dissipation rate transport equation was numerically solved.Thus the concentration of fire effluents as the function of mixture fraction and scalar dissipation rate can be calculated through a look-up table,and the toxic potency based on the 7-gas model can be obtained.The method was applied into an underground commercial street in Chongqing.It showed that the results between the 7-gas model and 3-gas model(CO,CO 2,and O 2) were obviously different.It indicated that there needs some modifications in conclusions and results from 3-gas model for fire-risk assessments.
文摘A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT (vincristine, 175 fold-resistancehigher than that in original KB cells) and ADM(adriamycin, 14. 5 fold) resulting over-expression ofMDRl. We used the primers for antisense RNA asfollowing: upstream 5′OGAATTCTGAAACCTGTAAGCAGCAACC 3′: downstream
基金supported by Special Scientific Research Funds for Central Non-profit Institutes,Chinese Academy of Fishery Sciences(2012A0401,2013A0501)
文摘Effects of copper toxicity and salinity shock on selective group of juvenile pompano Trachinotus ovatus were investigated.The fish were exposed to different Cu2+ concentrations of 0(blank),0.02(C1),0.05(C2),0.10(C3),and 0.15 mg·L–1(C4)at a salinity of 10‰ or 40‰ for 96 h,with the salinity of 29‰ as the control.The results showed that the effects of the acute salinity stimulation to survival rates of pompano between control(29‰)and lower or higher salinity for 96 h were not significant(p>0.05).However,the survival rates in each treatment were decreased with the increase of Cu2+ concentration.The dominant factor influencing body moisture of the fish was salinity,and there was no sign that body moisture was correlated with exposure to Cu2+.The gill lamellas in high level of Cu2+ concentration(C4 treatments)were abnormal under the salinity of 40‰ and extremely curly under the salinity of 10‰.Hemorrhage in gill was observed in the two C4 treatments.Under transmission electron microscope,pillar cells in gill lamellas appeared deformed and ruptured in some areas of the epithelia in the higher concentration of Cu2+,resulting in the death of the fish due to the destruction of gill tissue,elevation of the arithmetic mean distance from water to blood,the decrease of oxygen diffusion capacity,and other physiological functions.These findings indicate that the pompano might suffer much more pressure when encountered with Cu2+ pollution and low salinity.
文摘OBJECTIVE Vanadium is a necessary trace element in the human body and has a certain role in the treatment and prevention of diabetes.Organic vanadium is more easily absorbed and less toxic than inorganic vanadium.Thus,in this study,vanadium complex was synthesized from genistein which had good hypoglycemic activity and inor⁃ganic vanadium element,and its hypoglycemic activity and acute oral toxicity were studied.METHODS The vanadium genistein complex was synthesized by chelating vanadium with genistein in methanol and its structure was determined by LC-MS,atomic absorption spectroscopy,UV-visible spectroscopy,elemental and thermodynamic analysis.The antidiabetic activity of the complex was assessed in db/db mice and C57 mice by daily oral gavage for 4 weeks.These db/db mice were divided into test groups〔high(30 mg·kg^-1),medium(20 mg·kg^-1)and low(10 mg·kg^-1)dose group〕,model group,genistein group,inorganic vanadium group,each group of 8;8 C57 mice was for normal control group.The acute toxicity test was carried out on KM mice with this complex by a maximum limit dose method.Randomly 20 healthy KM mice were divided into negative control group and test group,each group of 10,male and female half.RESULTS The molecular structure of this complex was inferred as a complex(VL2)formed by two ligands and one vanadium element.It was found that its hypoglycemic activity was better than that of genistein and inorganic vanadium.The hypoglycemic activity of the high dose group was better than that of the medium dose group and low dose group.The complex can signifi⁃cantly improve the body mass of db/db mice,fasting blood glucose,random blood glucose,liver/body,kidney/body,and the performance of oral glucose tolerance test and insulin tolerance test in db/db mice.The morphology of liver,kidney,pancreas and skeletal muscle also had obvious improvement and repair.Effect on serum index of db/db mice showed that,total cholesterol,triglyceride,low-density lipoprotein cholesterol had no significant improvement compared with the model group,but high-density lipoprotein cholesterol of complex group had significant improvement compared with the model group.In addition,this complex did not produce any hazardous symptoms or deaths in acute oral toxicity test.CONCLUSION complex has good hypoglycemic activity in vivo,and did not have the potential toxicity.This would provide an important reference for the development of functional hypoglycemic foods.
文摘In order to evaluate the toxicity of the bisphenol A (BPA) on the growth of zebrafish embryos, fertilized eggs were exposed to the concentration of 2.00, 4.00, 6.00, 8.00, 10.00, 15.00, 18.00, 22.00 and 25.00mg/L BPA for 72 h at 26±1℃. The results revealed that the sublethal toxicological endpoints induced by BPA were:delayed hatch> blood balk >cyst>altered axial curvature and tail malformation. The median embryo lethal concentration (LC50) after 24 h was 16.36 mg/L. We concluded that the BPA toxicity on zebrafish embryos were caused before 8h exposure and it was not the result of long-term accumulation. Therefore, BPA maybe cause altered gene expression at the early stage of zebrafish embryos. In the further studies, we will use the technology of genetic chips to look for the toxic mechanism of BPA.
文摘LY-04 and WSQIF are newly-synthesized compounds which were presented by the Institute of Pesticides Chemistry, Central China Normal University. LY-04 belongs to α-oxophosphonic acid derivatives, while WSQIF is an aromatic acetyl oxophosphonic acid derivative. In this study, the toxicity of LY-04 and WSQIF on Scenedesmus obliquus Kütz was examined. The EC 50 of LY-04 and WSQIF were determined in S. obliquus cells at 24h, 48h, 72h, 96h represented by cell density. Our data showed that the 24h, 48h, 72h, 96h EC 50 of LY-04 were 1983mg/L, 2943mg/L, 240mg/L and 65.0mg/L acetone, respectively, and the 24h, 48h, 72h, 96h EC 50 of WSQIF were 15.9mg/L, 53.0mg/L, 98.0mg/L and 28.8mg/L respectively. LY-04 displayed a higher insecticidal activity, while WSQIF showed a higher phytocidal activity. As LY-04 and WSQIF were designed to act as insecticide and herbicide, respectively, the results were in contrast to the anticipated ones. According to the toxicant classification standard, EC 50 of both substances was far higher than 3mg/L, while the toxicity of LY-04 and WSQIF to aquatic algae were fairly low, indicating that these two pesticides are rather safe to the aquatic ecosystem.
文摘Persistent perfluorinated organic compounds, such as perfluorooctane sulfonate (PFOS) and perfluorooctanoate (PFOA) are used in a variety of industrial applications. They are very stable in the environment, distribute widely in the global environment and in wild life, and are detected in human sera. Our searches have detected ppt levels of PFOS and PFOA in the surface water of Japan and China; their levels are generally more than ten times higher in city areas. Neither PFOS nor PFOA is removed by the purification process of city water. Both PFOS and PFOA are detected in sera of all the people of Japan and China (about 1000 times as high as those in surface water), and their concentrations are increasing in both countries, especially in China. PFOS and PFOA primarily distribute to the liver and cause the liver toxicity. They also cause developmental toxicity. PFOS which is not genotoxic in a variety of assay system including our in vivo comet assay, induced tumors of the liver, thyroid and mammary gland of rats. PFOA which is weakly carcinogenic is not mutagenic in many studies including our in vivo comet assay.
文摘In order to evaluate the toxicity of compound planks in ships exposed to room and high temperature and provide the scientific basis for correct and rational screening of these materials,the room temperature released products and high-temperature decomposed products of 2 kinds of compound planks were analyzed quantitatively by GC-MS technique.
文摘In order to evaluate the toxicity of adhesive in ships exposed to room and high temperature and provide the scientific basis for correct and rational screening of these materials,the room temperature released products and high-temperature decomposed products of 3 kinds of special adhesive were analyzed quantitatively by GC-MS technique.
文摘The spectrum user’s librarys containing 1533 familiar toxicants have been built; A method with high separability and sensitivity has been found,The RT and the detection limit of 210 familiar abuse drugs has been confirmed; the processing methods to analyse spectrum data automatically have been found; It is simple,quick,sensitive and reliable,and can take place of manual operation,It is very useful to screen the familiar toxicants in unkown sample.
文摘A series of batch experiments were conducted in 125 mL serum bottles to assess the toxicity of different concentrations of ammonia nitrogen to the specific methanogenic activity of anaerobic granular sludge from upflow anaerobic sludge bed(UASB) and expanded granular sludge bed(EGSB) reactors. The effects of pH value and temperature on toxicity of ammonia nitrogen to anaerobes were investigated. The results show that the specific methanogenic activity of anaerobic granular sludge suffers inhibition from ammonia nitrogen, the concentrations of ammonia nitrogen that produce 50 % inhibition of specific methanogenic activity for sludge from UASB and EGSB reactor are 2.35 and 2.75 g/L, respectively. Hydrogen utilizing methanogens suffers less inhibition from ammonia mtrogen than that of acetate utilizing methanogens. Hydrogen-producing acetogens that utilize propionate and butyrate as substrates suffer serious inhibition from ammonia nitrogen. The toxicity of ammonia nitrogen to anaerobic granular sludge enhances when pH value and temperature increase. Anaerobic granular sludge can bear higher concentrations of ammonia nitrogen after being acclimated by ammonia nitrogen for 7 d.
基金Project(202202AG050010)supported by the Yunnan Major Scientific and Technological Projects,ChinaProject(202103AA080007)supported by the Key R&D Project of Science and Technology Department of Yunnan Province,ChinaProject(NECP2023-06)supported by the Open Project Fund of National Engineering and Technology Research Center for Development&Utilization of Phosphorous Resources,China。
文摘The long-term storage of phosphate tailings will occupy a large amount of land,pollute soil and groundwater,thus,it is crucial to achieve the harmless disposal of phosphate tailings.In this study,high-performance geopolymers with compressive strength of 38.8 MPa were prepared by using phosphate tailings as the main raw material,fly ash as the active silicon-aluminum material,and water glass as the alkaline activator.The solid content of phosphate tailings and fly ash was 60%and 40%,respectively,and the water-cement ratio was 0.22.The results of XRD,FTIR,SEM-EDS and XPS show that the reactivity of phosphate tailings with alkaline activator is weak,and the silicon-aluminum material can react with alkaline activator to form zeolite and gel,and encapsulate/cover the phosphate tailings to form a dense phosphate tailings-based geopolymer.During the formation of geopolymers,part of the aluminum-oxygen tetrahedron replaced the silicon-oxygen tetrahedron,causing the polycondensation reaction between geopolymers and increasing the strength of geopolymers.The leaching toxicity test results show that the geopolymer has a good solid sealing effect on heavy metal ions.The preparation of geopolymer from phosphate tailings is an important way to alleviate the storage pressure and realize the resource utilization of phosphate tailings.
基金Supported by Knowledge Innovation Program of Chinese Academy of Sciences (KSCX-YW-09)Technological Key Projects Undertaken During "11th Five Year" Period in Heilongjiang Province (GA06B101)
文摘The concentration of heavy metals was investigated in black soil samples collected from the fields treated with chemical in Bayan County which were from the vegetation covers,bare soil and grain fields without any chemical treatments in Hailun National Field Research Station of Agroecosystem,Chinese Academy of Sciences (CAS) in July,2009.Results showed that the presence of significantly high concentration of zinc (Zn) and lead (Pb) in soils covered with grass vegetation.However,mercury (Hg),copper (Cu),nick...
文摘Atrazine (ATR) and chlorpyrifos (CPF) are widely used in agriculture, but have resulted in a series of toxicological and environmental problems. They were heavily used which have potential threat to fish and rodents. Several recent laboratory studies have shown ATR and CPF could lead to oxidative damage, immunocyte reduced and inhibit acetylcholinesterase (ACHE). In order to clarify the toxicity of ATR and CPF, this paper summarized the adverse effects of ATR and CPF on reproduction, nerve and immune systems in fish.