Machado-Joseph disease,or spinocerebellar ataxia type 3(SCA3),represents the most common autosomal dominant cerebellar ataxia worldwide.Despite its progressive and debilitating nature,disease-modifying therapies remai...Machado-Joseph disease,or spinocerebellar ataxia type 3(SCA3),represents the most common autosomal dominant cerebellar ataxia worldwide.Despite its progressive and debilitating nature,disease-modifying therapies remain elusive.Repetitive transcranial magnetic stimulation(rTMS)has emerged as a promising non-invasive intervention;however,its clinical application has been hindered by inconsistent protocols and a lack of mechanistic understanding.A recent landmark study published in Brain Stimulation by Chen et al.addressed these challenges by combining a high-dose intermittent theta-burst stimulation(iTBS)protocol with concurrent transcranial magnetic stimulation-electroencephalography(TMS-EEG).This commentary provides an in-depth analysis of their findings,highlighting the restoration of cerebello-cortical inhibition(CBI)as a key therapeutic mechanism.Furthermore,we discuss the broader implications of this work,proposing that future translational research should integrate accelerated iTBS(aiTBS)paradigms,cortical response measurements(CRM),and individualized neuro-navigation to establish a new era of precision neuromodulation for ataxia.展开更多
The efficient recovery of fluorite is paid more and more attention with the increasing application especially in strategic emerging industries.In this study,acrylic acid-2-acrylamido-2-methylpropane sulfonic acid copo...The efficient recovery of fluorite is paid more and more attention with the increasing application especially in strategic emerging industries.In this study,acrylic acid-2-acrylamido-2-methylpropane sulfonic acid copolymer(AAAMPS)was first used as the depressant in fluorite flotation,and its effect on the flotation separation of fluorite and dolomite in sodium oleate(NaOL)system was investigated.The depression mechanism was analyzed by contact angle measurement,zeta potential test,FTIR and XPS analyses.The micro-flotation test results showed that dolomite can be inhibited in fluorite flotation system in the addition of 2 mg/L AA-AMPS and 20 mg/L NaOL at pH 10.The CaF_(2) grade increased from 49.85%in the artificial mixed mineral to 89.60%in the fluorite concentrate.The depression mechanism indicated that AA-AMPS could adsorb strongly on dolomite surface by the chelation with Ca and Mg active sites.Moreover,the further adsorption of NaOL on dolomite surface was prevented by the AA-AMPS adsorption,but that on fluorite surface was little affected,thereby increasing the difference in the hydrophobicity and floatability of the two minerals.展开更多
The synergistic inhibition effect of CeCl3(Ce)and serine(Ser)on the corrosion of carbon steel in a 3%NaCl solution was investigated by electrochemical methods and surface analysis.The results showed that both CeCl3 an...The synergistic inhibition effect of CeCl3(Ce)and serine(Ser)on the corrosion of carbon steel in a 3%NaCl solution was investigated by electrochemical methods and surface analysis.The results showed that both CeCl3 and Ser,when used alone,had limited inhibition effect toward carbon steel corrosion in the 3%NaCl solution.In contrast,the combination of CeCl3 with Ser produced a strong synergistic effect on the corrosion inhibition behavior of carbon steel,improving the inhibition efficiency significantly.The polarization curves showed that the mixture of CeCl3 and Ser acts as a cationic-type inhibitor.Scanning electron microscopy and Fourier transform infrared spectroscopy showed that the synergistic inhibition effect was due to complex formation between the cerium ions and amino acid molecules.展开更多
The action between imidazolinyl-quaternary-ammonium-salt(IQAS) molecule and Fe atom was studied, and the influence of the alkyl group connected with N atom of imidazoline ring on corrosion inhibition efficiency was ex...The action between imidazolinyl-quaternary-ammonium-salt(IQAS) molecule and Fe atom was studied, and the influence of the alkyl group connected with N atom of imidazoline ring on corrosion inhibition efficiency was explored. Quantum chemical methods, HF/6-31 G and HF/Lan L2 dz, were applied successively to calculate the parameters such as front molecular orbit energy of IQASⅠ-Ⅳ and chemical adsorption for IQASⅠ-Ⅳ and Fe atom. The corrosion inhibition efficiency was measured with the weight loss method of carbon steel samples in acidic solution and oil field sewage. Based on the theoretical analyses and experimental results, it is concluded that N-Fe coordination bond is formed between IQAS molecule and Fe atom, corrosion inhibition efficiency is decreased in the following order(from large to small): IQAS Ⅳ, IQAS Ⅲ, IQAS Ⅱ, IQASⅠ.展开更多
Inhibition mechanism between sodium (NaaAlF6) and sulfur on coke reactivity was investigated by simulating petroleum coke with low-impurity pitch coke and by impurity doping. The mechanism was discussed by scanning ...Inhibition mechanism between sodium (NaaAlF6) and sulfur on coke reactivity was investigated by simulating petroleum coke with low-impurity pitch coke and by impurity doping. The mechanism was discussed by scanning electron microscopy, energy-dispersive spectrometry, and X-ray powder diffraction. Results show that Na effectively inhibited S catalysis during carbon-air/CO2 reactions, and S inhibited the catalysis of Na during carbon- air reaction to a certain extent. A stable structure with a Na-to-S atomic ratio of 1.4 and a cyclic reaction system of "Na2SO3→ Na2S→Na2CO3→ Na2SO3" were likely the keys to producing this mutual inhibition.展开更多
It is difficult for the double suppression division algorithm of bee colony to solve the spatio-temporal coupling or have higher dimensional attributes and undertake sudden tasks.Using the idea of clustering,after clu...It is difficult for the double suppression division algorithm of bee colony to solve the spatio-temporal coupling or have higher dimensional attributes and undertake sudden tasks.Using the idea of clustering,after clustering tasks according to spatio-temporal attributes,the clustered groups are linked into task sub-chains according to similarity.Then,based on the correlation between clusters,the child chains are connected to form a task chain.Therefore,the limitation is solved that the task chain in the bee colony algorithm can only be connected according to one dimension.When a sudden task occurs,a method of inserting a small number of tasks into the original task chain and a task chain reconstruction method are designed according to the relative relationship between the number of sudden tasks and the number of remaining tasks.Through the above improvements,the algorithm can be used to process tasks with spatio-temporal coupling and burst tasks.In order to reflect the efficiency and applicability of the algorithm,a task allocation model for the unmanned aerial vehicle(UAV)group is constructed,and a one-to-one correspondence between the improved bee colony double suppression division algorithm and each attribute in the UAV group is proposed.Task assignment has been constructed.The study uses the self-adjusting characteristics of the bee colony to achieve task allocation.Simulation verification and algorithm comparison show that the algorithm has stronger planning advantages and algorithm performance.展开更多
The compound(4-chlorophenyl)-N-(4-methylphenyl)nitrone(4CPNMPN)has been selected as one of the new nitrone derivative for our study.The molecular structure of the compound was investigated based on frontier orbital an...The compound(4-chlorophenyl)-N-(4-methylphenyl)nitrone(4CPNMPN)has been selected as one of the new nitrone derivative for our study.The molecular structure of the compound was investigated based on frontier orbital analysis and natural bond orbital(NBO)theory.The present work also focuses on the inhibition efficiency of the compound.It is an attempt to find the correlation between the molecular structure of the compound and possible behaviour like corrosion inhibitors.The NBO analysis and the values of electric dipole moment(μ)of the investigated molecule were computed using DFT calculations.The molecule orbital contributions were studied by using the total(TDOS)density of states.The strong evidences that the compound can be used as an efficient nonlinear optical(NLO)of 4CPNMPN were demonstrated by considerable polarizability and hyperpolarizability values obtained at DFT levels.展开更多
OBJECTIVE Sheng Jiang San(SJS),a multi-herb formulation,is used in treating high fever,thirsty and anxiety in ancient China and it is sometimes used to treat seasonal influenza in modern.However,there is no evidenceba...OBJECTIVE Sheng Jiang San(SJS),a multi-herb formulation,is used in treating high fever,thirsty and anxiety in ancient China and it is sometimes used to treat seasonal influenza in modern.However,there is no evidencebased investigation and mechanism research to support SJS′s anti-influenza efficacy.This study aims to investigate the anti-influenza effect of SJS and its possible mechanisms.METHODS In this study,we examined the inhibitory effect of SJS against different influenza viruses on Madin-Darby canine kidney cells.Influenza virus infected BALB/c mice were employed as in vivo model to evaluate the efficacy.Mice challenged with A/PR/8/34(H1N1)were orally administrated SJS 1 g·kg^-1 daily for seven days and monitored for 14 d.The survival rate,body mass changes,lung index,lung viral load,histopathologic changes and immune-regulation of the mice were measured.The underlying anti-influenza virus mechanisms were studied by a series of biological assays in vitro to determine if hemagglutinin,ribonucleoprotein complex or nerauminidase were targets of SJS.RESULTS SJS exerted a broad spectrum of inhibitory effects on multiple influenza strains in a dose-dependent manner.And IC50 of SJS against A/WSN/33(H1N1)was lower than 35 mg·L^-1.SJS also protected 50%of mice from influenza virus PR8 infection.The lung index and the lung viral load of SJS treated mice were signifi⁃cantly decrease compared with untreated mice.SJS 2 g·L^-1 inhibited 80%of neuraminidase enzymatic activity.SJS also up-regulated TNF-αand IFN-αand down-regulated IL-2 of influenza virus induced mice.CONCLUSION SJS is a useful formulation for treating influenza virus infection.展开更多
Objectives: To construct retroviral vectorsexpressing antisense polymeric RNAs targeted at the coresequence (+13-+47) of HIV-l TAR RNA, and to testthe anti-HIV properties of this construct in transducedCD4^+T cells. M...Objectives: To construct retroviral vectorsexpressing antisense polymeric RNAs targeted at the coresequence (+13-+47) of HIV-l TAR RNA, and to testthe anti-HIV properties of this construct in transducedCD4^+T cells. Methods: The polymeric TAR-Core DNAwas amplified by the"self-primers-template PCR"展开更多
Aim Previous studies showed that the inhibition of proteasome activity could significantly improve cardi- ac hypertrophy, but its mechanism is not clear. Increased glycogen synthase kinase-3 (GSK-3) activity can als...Aim Previous studies showed that the inhibition of proteasome activity could significantly improve cardi- ac hypertrophy, but its mechanism is not clear. Increased glycogen synthase kinase-3 (GSK-3) activity can also improve cardiac hypertrophy. However, the relationship between proteasome and GSK-3 has not been reported in cardiomyocyte In this study, we will investigate the effect of proteasome inhibition on cardiomyocyte hypertrophy, GSK-3 activity and the underlying mechanism. Methods Primary neonatal rat cardiomyocytes were divided into 4 groups: Control, Ang H (100 nmol · L^-1 48 h) Ang Ⅱ ( 100 nmol · L^-1) + MG132 (0.05 μmol · L^-1) MG132 (0.05 μmol · L^-1) ,Ang 11 (100 nmol · L^-1 ) + MG132 + LiC1 ( 10 mmol · L^-1 ), LiC1. Proteasome activitiy was detected by fluorescent peptide substrate. Cardiomyocyte surface area, ANF mRNA expression, and the rate of protein synthesis were observed as myocardial hypertrophy index. GSK-3, Akt, AMPKoL, and Histone3 (H3) were detected by Western Blot. The expression of GATA4 in the cytoplasm and nucleus was observed by im- munofluorescence. Results (1) Compared with the control group, myocardial ANF mRNA expression, the rate of protein synthesis and cell surface area were all increased in Ang H group. The chymotrypsin-like, trypsin-like and caspase-like activities of proteasome were all increased significantly. The phosphorylated level of both GSK-3α( p- GSK-3α) ( Ser21 ) and GSK-3β (p-GSK-3β ) (Ser9) increased, i. e they were inactivated. (2) Compared with the Ang II group, myocardial ANF mRNA expression, the rate of protein synthesis and cell surface area were all decreased after proteasome inhibition. And p-GSK-3 (Ser21) and p-GSK-3β (Ser9) was respondingly decreased, (3) Proteasome inhibition also resulted in the decrease of p-Akt (Ser473) and p-AMPKa (Thr172)7 which in- creased in cardiomyocyte hypertrophy. Immunofluorescence showed that GATA4 was mainly distributed in the nu- cleus after Ang II treatment, while it was obviously increased in the cytoplasm after proteasome inhibition. After the GSK-3 inhibitor-LiC1 was given, the above indicators were reversed. (4) p-Histone3 was also increased in cardio- myocyte hypertrophy and MG132 reduced its level, but LiC1 treatment had no significant effect on its level. Con- clusion Proteasome inhibition reduces cardiomyocyte hypertrophy through increase of GSK-3a/b activity, which may be related with the decrease of Akt and AMPKa activities, and the decrease of nucleus location of GATA4, but p-histone3 is not involved.展开更多
OBJECTIVE Microglial activation-mediated neuroinflammation plays an important pathological basis in the progression of many neurodegenerative diseases.Activated microglia cells show a metabolic shift from oxidative ph...OBJECTIVE Microglial activation-mediated neuroinflammation plays an important pathological basis in the progression of many neurodegenerative diseases.Activated microglia cells show a metabolic shift from oxidative phos⁃phorylation to aerobic glycolysis.However,the molecular mechanism underlying the role of glycolysis in microglial activation and progres⁃sion of neuroinflammatory diseases have not yet been fully understood.METHODS The anti-inflammatory effects and its underlying mecha⁃nisms of glycolytic inhibition in vitro were exam⁃ined in lipopolysaccharide(LPS)activated BV-2 microglial cells or primary microglial cells by enzyme-linked immunosorbent assay(ELISA),quantitative reverse transcriptase polymerase chain reaction(RT-PCR),Western blotting,immunoprecipitation,Flow cytometry and nuclear factor kappa B(NF-κB)luciferase reporter assays.In vivo,the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine(MPTP)-or LPS-induced Par⁃kinson disease(PD)models were constructed to explored the anti-inflammatory and neuropro⁃tective effects of glycolytic inhibitor.RESULTS Inhibition of glycolysis by specific inhibitors[2-DG and 3-bromopyruvic acid(3-BPA)],knockdown of glucose transporter type 1(Glut-1)or hexoki⁃nase(HK)Ⅱabolished LPS-induced expres⁃sion of proinflammatory genes in microglia cells.Mechanistic studies demonstrated that glyco⁃lytic inhibitors significantly inhibited LPS-induced mTOR phosphorylation,IKKβphosphorylation,IκB phosphorylation,IκB degradation,nuclear translocation of P65 and NF-κB luciferase activity.Furthermore,LPS-induced P65 acetyla⁃tion on lysine 310,which is mediated by NAD-dependent protein deacetylase sirtuin-1 and is critical for NF-kB activation,were inhibited by glycolytic inhibitors.A coculture study revealed that 2-DG reduced the cytotoxicity of activated microglia toward MES23.5 dopaminergic neuron cells with no direct protective effect.In vivo,2-DG significantly ameliorated MPTP or LPS induced DA neuron loss and glial cell activation.CONCLUSION Glycolysis is actively involved in microglial activation.Inhibition of glycolysis can ameliorate microglial activation-related neuroinflammatory diseases.展开更多
A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT (vincristine, 175 fold-resistancehigher than that in original KB cells) and ADM(...A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT (vincristine, 175 fold-resistancehigher than that in original KB cells) and ADM(adriamycin, 14. 5 fold) resulting over-expression ofMDRl. We used the primers for antisense RNA asfollowing: upstream 5′OGAATTCTGAAACCTGTAAGCAGCAACC 3′: downstream展开更多
OBJECTIVE Prepulse inhibition(PPI)of the acoustic startle response provides a measure of sensorimotor gating system mecha⁃nisms,which is known to be impaired in schizo⁃phrenia patients.We assessed the effects of the 5...OBJECTIVE Prepulse inhibition(PPI)of the acoustic startle response provides a measure of sensorimotor gating system mecha⁃nisms,which is known to be impaired in schizo⁃phrenia patients.We assessed the effects of the 5-HT2A/2C receptor agonist(±)2,5-dimethoxy-4-methylamphetamine(DOM),the NMDA receptor antagonist ketamine,the dopamine receptor ago⁃nist methamphetamine(Meth)on PPI and the startle magnitude in SD rats.METHODS AND RESULTS Systemic administration of the three compounds all dose-dependently reduced PPI.However,as far as startle magnitude,only DOM at the doses of 3 mg·kg-1 reduced that,while both ketamine and Meth did not change the startle magnitudes.Furthermore,to determine whether 5-HT2A receptor mediate this effect,the non-spe⁃cific 5-HT2 receptor antagonist cyproheptadine,specific 5-HT2A receptor antagonist ketanserin and specific 5-HT2C receptor antagonist SB242084 were tested.Cyproheptadine,ketan⁃serin and SB242084 did not alter startle ampli⁃tude by themselves in SD rats and only ketanserin slightly increased PPI at higher dose(3 mg·kg-1).PPI impairment induced by DOM was restored by pretreatment of cyproheptadine(1 mg·kg-1)and ketanserin(1 mg·kg-1),while not by pretreat⁃ment of SB242084(1 mg·kg-1).Damage of PPI induced by ketamine and Meth was not reversed by cyproheptadine(1 and 5 mg·kg-1).CONCLU⁃SION The receptor mechanisms underlying the disruption of PPI caused by DOM,ketamine and Meth were different from each other,at least 5-HT2A receptor was not the junction receptor for which the three chemicals acted.展开更多
Background and Objective Lung cancer, which has been proved to have fastest increasing rate of morbidity and mortality, appears to be one of the most dangerous malignant tumor that
We have examined the theoretical implications of combining two main and three auxiliary ligands to form several Ir(Ⅲ)complexes featuring a transition metal as their core atom to identify some appropriate organic ligh...We have examined the theoretical implications of combining two main and three auxiliary ligands to form several Ir(Ⅲ)complexes featuring a transition metal as their core atom to identify some appropriate organic lightemitting diode(OLED)materials.By utilizing electronic structure,frontier molecular orbitals,minimum single-line absorption,triplet excited states,and emission spectral data derived from the density functional theory,the usefulness of these Ir(Ⅲ)complexes,including(piq)_(2)Ir(acac),(piq)_(2)Ir(tmd),(piq)_(2)Ir(tpip),(fpiq)_(2)Ir(acac),(fpiq)_(2)Ir(tmd),and(fpiq)_(2)Ir(tpip),in OLEDs was examined,where piq=1-phenylisoquinoline,fpiq=1-(4-fluorophenyl)isoquinoline,acac=(3Z)-4-hydroxypent-3-en-2-one,tmd=(4Z)-5-hydroxy-2,2,6,6-tetramethylhept-4-en-3-one,and tpip=tetraphenylimido-diphosphonate.These complexes all have low-efficiency roll-off properties,especially(fpiq)_(2)Ir(tpip).Some researchers have successfully synthesized complexes extremely similar to(piq)_(2)Ir(acac)through the Suzuki-Miyaura coupling reaction.展开更多
Background Polygalacturonase inhibiting proteins(PGIPs)play a pivotal role in plant defense against plant patho-gens by inhibiting polygalacturonase(PG),an enzyme produced by pathogens to degrade plant cell wall pecti...Background Polygalacturonase inhibiting proteins(PGIPs)play a pivotal role in plant defense against plant patho-gens by inhibiting polygalacturonase(PG),an enzyme produced by pathogens to degrade plant cell wall pectin.PGIPs,also known as leucine-rich repeat pathogenesis-related(PR)proteins,activate the host’s defense response upon interaction with PG,thereby reinforcing the host defense against plant pathogens attacks.In Egyptian or extra-long staple cotton(Gossypium barbadense),the interaction between PGIP and PG is one of the crucial steps in the defense mechanism against major pathogens such as Xanthomonas citri pv.malvacearum and Alternaria mac-rospora,which are responsible for bacterial leaf blight and leaf spot diseases,respectively.Results To unravel the molecular mechanisms underlying these PR proteins,we conducted a comprehensive study involving molecular modeling,protein-protein docking,site-specific double mutation(E169G and F242K),and molec-ular dynamics simulations.Both wild-type and mutated cotton PGIPs were examined in the interaction with the PG enzyme of a bacterial and fungal pathogen.Our findings revealed that changes in conformations of double-mutated residues in the active site of PGIP lead to the inhibition of PG binding.The molecular dynamics simulation studies provide insights into the dynamic behaviour and stability of the PGIP-PG complexes,shedding light on the intricate details of the inhibitory and exhibitory mechanism against the major fungal and bacterial pathogens of G.barbadense,respectively.Conclusions The findings of this study not only enhance our understanding of the molecular interactions between PGs of Xanthomonas citri pv.malvacearum and Alternaria macrospora and PGIP of G.barbadense but also pre-sent a potential strategy for developing the disease-resistant cotton varieties.By variations in the binding affinities of PGs through specific mutations in PGIP,this research offers promising avenues for the development of enhanced resistance to cotton plants against bacterial leaf blight and leaf spot diseases.展开更多
The intersection is a widely used traffic line structure from the shallow tunnel to the deep roadway,and determining the subsidence hidden danger area of the roof is the key to its stability control.However,applying t...The intersection is a widely used traffic line structure from the shallow tunnel to the deep roadway,and determining the subsidence hidden danger area of the roof is the key to its stability control.However,applying traditional maximum equivalent span beam(MESB)theory to determine deformation range,peak point,and angle influence poses a challenge.Considering the overall structure of the intersection roof,the maximum equivalent triangular plate(METP)theory is proposed,and its geometric parameter calculation formula and deflection calculation formula are obtained.The application of the two theories in 18 models with different intersection angles,roadway types,and surrounding rock lithology is verified by numerical analysis.The results show that:1)The METP structure of the intersection roof established by the simulation results of each model successfully determined the location of the roof’s high displacement zone;2)The area comparison method of the METP theory can be reasonably explained:①The roof subsidence of the intersection decreases with the increase of the intersection angle;②The roof subsidence at the intersection of different roadway types has a rectangular type>arch type>circular type;③The roof subsidence of the intersection with weak surrounding rock is significantly larger than that of the intersection with hard surrounding rock.According to the application results of the two theories,the four advantages of the METP theory are compared and clarified in the basic assumptions,mechanical models,main viewpoints,and mechanism analysis.The large deformation inducement of the intersection roof is then explored.The J 2 peak area of the roof drives the large deformation of the area,the peak point of which is consistent with the center of gravity position of the METP.Furthermore,the change in the range of this peak is consistent with the change law of the METP’s area.Hence,this theory clarifies the large deformation area of the intersection roof,which provides a clear guiding basis for its initial support design,mid-term monitoring,and late local reinforcement.展开更多
基金supported by grants from the Open Research Fund of the Zhejiang Key Laboratory of Precision Psychiatry(2025A2)the Natural Science Foundation of Zhejiang Province(LY23C090002)。
文摘Machado-Joseph disease,or spinocerebellar ataxia type 3(SCA3),represents the most common autosomal dominant cerebellar ataxia worldwide.Despite its progressive and debilitating nature,disease-modifying therapies remain elusive.Repetitive transcranial magnetic stimulation(rTMS)has emerged as a promising non-invasive intervention;however,its clinical application has been hindered by inconsistent protocols and a lack of mechanistic understanding.A recent landmark study published in Brain Stimulation by Chen et al.addressed these challenges by combining a high-dose intermittent theta-burst stimulation(iTBS)protocol with concurrent transcranial magnetic stimulation-electroencephalography(TMS-EEG).This commentary provides an in-depth analysis of their findings,highlighting the restoration of cerebello-cortical inhibition(CBI)as a key therapeutic mechanism.Furthermore,we discuss the broader implications of this work,proposing that future translational research should integrate accelerated iTBS(aiTBS)paradigms,cortical response measurements(CRM),and individualized neuro-navigation to establish a new era of precision neuromodulation for ataxia.
基金Project(52004333)supported by the National Science Foundation of ChinaProject(2021CB1002)supported by Hunan International Joint Research Center for Efficient and Clean Utilization of Critical Metal Mineral Resources,China。
文摘The efficient recovery of fluorite is paid more and more attention with the increasing application especially in strategic emerging industries.In this study,acrylic acid-2-acrylamido-2-methylpropane sulfonic acid copolymer(AAAMPS)was first used as the depressant in fluorite flotation,and its effect on the flotation separation of fluorite and dolomite in sodium oleate(NaOL)system was investigated.The depression mechanism was analyzed by contact angle measurement,zeta potential test,FTIR and XPS analyses.The micro-flotation test results showed that dolomite can be inhibited in fluorite flotation system in the addition of 2 mg/L AA-AMPS and 20 mg/L NaOL at pH 10.The CaF_(2) grade increased from 49.85%in the artificial mixed mineral to 89.60%in the fluorite concentrate.The depression mechanism indicated that AA-AMPS could adsorb strongly on dolomite surface by the chelation with Ca and Mg active sites.Moreover,the further adsorption of NaOL on dolomite surface was prevented by the AA-AMPS adsorption,but that on fluorite surface was little affected,thereby increasing the difference in the hydrophobicity and floatability of the two minerals.
基金Project(2017210101002066)supported by the Crosswise Project of Liaoning province,China
文摘The synergistic inhibition effect of CeCl3(Ce)and serine(Ser)on the corrosion of carbon steel in a 3%NaCl solution was investigated by electrochemical methods and surface analysis.The results showed that both CeCl3 and Ser,when used alone,had limited inhibition effect toward carbon steel corrosion in the 3%NaCl solution.In contrast,the combination of CeCl3 with Ser produced a strong synergistic effect on the corrosion inhibition behavior of carbon steel,improving the inhibition efficiency significantly.The polarization curves showed that the mixture of CeCl3 and Ser acts as a cationic-type inhibitor.Scanning electron microscopy and Fourier transform infrared spectroscopy showed that the synergistic inhibition effect was due to complex formation between the cerium ions and amino acid molecules.
基金Project (05A002) supported by Scientific Research Fundation of Hunan Provincial Education Depart ment project(04JJY40010) supported by the Natural Science Foundation of Hunan Province
文摘The action between imidazolinyl-quaternary-ammonium-salt(IQAS) molecule and Fe atom was studied, and the influence of the alkyl group connected with N atom of imidazoline ring on corrosion inhibition efficiency was explored. Quantum chemical methods, HF/6-31 G and HF/Lan L2 dz, were applied successively to calculate the parameters such as front molecular orbit energy of IQASⅠ-Ⅳ and chemical adsorption for IQASⅠ-Ⅳ and Fe atom. The corrosion inhibition efficiency was measured with the weight loss method of carbon steel samples in acidic solution and oil field sewage. Based on the theoretical analyses and experimental results, it is concluded that N-Fe coordination bond is formed between IQAS molecule and Fe atom, corrosion inhibition efficiency is decreased in the following order(from large to small): IQAS Ⅳ, IQAS Ⅲ, IQAS Ⅱ, IQASⅠ.
基金Projects(51374253,51574289)supported by the National Natural Science Foundation of China
文摘Inhibition mechanism between sodium (NaaAlF6) and sulfur on coke reactivity was investigated by simulating petroleum coke with low-impurity pitch coke and by impurity doping. The mechanism was discussed by scanning electron microscopy, energy-dispersive spectrometry, and X-ray powder diffraction. Results show that Na effectively inhibited S catalysis during carbon-air/CO2 reactions, and S inhibited the catalysis of Na during carbon- air reaction to a certain extent. A stable structure with a Na-to-S atomic ratio of 1.4 and a cyclic reaction system of "Na2SO3→ Na2S→Na2CO3→ Na2SO3" were likely the keys to producing this mutual inhibition.
基金This work was supported by the National Natural Science and Technology Innovation 2030 Major Project of Ministry of Science and Technology of China(2018AAA0101200)the National Natural Science Foundation of China(61502522,61502534)+4 种基金the Equipment Pre-Research Field Fund(JZX7Y20190253036101)the Equipment Pre-Research Ministry of Education Joint Fund(6141A02033703)Shaanxi Provincial Natural Science Foundation(2020JQ-493)the Military Science Project of the National Social Science Fund(WJ2019-SKJJ-C-092)the Theoretical Research Foundation of Armed Police Engineering University(WJY202148).
文摘It is difficult for the double suppression division algorithm of bee colony to solve the spatio-temporal coupling or have higher dimensional attributes and undertake sudden tasks.Using the idea of clustering,after clustering tasks according to spatio-temporal attributes,the clustered groups are linked into task sub-chains according to similarity.Then,based on the correlation between clusters,the child chains are connected to form a task chain.Therefore,the limitation is solved that the task chain in the bee colony algorithm can only be connected according to one dimension.When a sudden task occurs,a method of inserting a small number of tasks into the original task chain and a task chain reconstruction method are designed according to the relative relationship between the number of sudden tasks and the number of remaining tasks.Through the above improvements,the algorithm can be used to process tasks with spatio-temporal coupling and burst tasks.In order to reflect the efficiency and applicability of the algorithm,a task allocation model for the unmanned aerial vehicle(UAV)group is constructed,and a one-to-one correspondence between the improved bee colony double suppression division algorithm and each attribute in the UAV group is proposed.Task assignment has been constructed.The study uses the self-adjusting characteristics of the bee colony to achieve task allocation.Simulation verification and algorithm comparison show that the algorithm has stronger planning advantages and algorithm performance.
文摘The compound(4-chlorophenyl)-N-(4-methylphenyl)nitrone(4CPNMPN)has been selected as one of the new nitrone derivative for our study.The molecular structure of the compound was investigated based on frontier orbital analysis and natural bond orbital(NBO)theory.The present work also focuses on the inhibition efficiency of the compound.It is an attempt to find the correlation between the molecular structure of the compound and possible behaviour like corrosion inhibitors.The NBO analysis and the values of electric dipole moment(μ)of the investigated molecule were computed using DFT calculations.The molecule orbital contributions were studied by using the total(TDOS)density of states.The strong evidences that the compound can be used as an efficient nonlinear optical(NLO)of 4CPNMPN were demonstrated by considerable polarizability and hyperpolarizability values obtained at DFT levels.
文摘OBJECTIVE Sheng Jiang San(SJS),a multi-herb formulation,is used in treating high fever,thirsty and anxiety in ancient China and it is sometimes used to treat seasonal influenza in modern.However,there is no evidencebased investigation and mechanism research to support SJS′s anti-influenza efficacy.This study aims to investigate the anti-influenza effect of SJS and its possible mechanisms.METHODS In this study,we examined the inhibitory effect of SJS against different influenza viruses on Madin-Darby canine kidney cells.Influenza virus infected BALB/c mice were employed as in vivo model to evaluate the efficacy.Mice challenged with A/PR/8/34(H1N1)were orally administrated SJS 1 g·kg^-1 daily for seven days and monitored for 14 d.The survival rate,body mass changes,lung index,lung viral load,histopathologic changes and immune-regulation of the mice were measured.The underlying anti-influenza virus mechanisms were studied by a series of biological assays in vitro to determine if hemagglutinin,ribonucleoprotein complex or nerauminidase were targets of SJS.RESULTS SJS exerted a broad spectrum of inhibitory effects on multiple influenza strains in a dose-dependent manner.And IC50 of SJS against A/WSN/33(H1N1)was lower than 35 mg·L^-1.SJS also protected 50%of mice from influenza virus PR8 infection.The lung index and the lung viral load of SJS treated mice were signifi⁃cantly decrease compared with untreated mice.SJS 2 g·L^-1 inhibited 80%of neuraminidase enzymatic activity.SJS also up-regulated TNF-αand IFN-αand down-regulated IL-2 of influenza virus induced mice.CONCLUSION SJS is a useful formulation for treating influenza virus infection.
文摘Objectives: To construct retroviral vectorsexpressing antisense polymeric RNAs targeted at the coresequence (+13-+47) of HIV-l TAR RNA, and to testthe anti-HIV properties of this construct in transducedCD4^+T cells. Methods: The polymeric TAR-Core DNAwas amplified by the"self-primers-template PCR"
文摘Aim Previous studies showed that the inhibition of proteasome activity could significantly improve cardi- ac hypertrophy, but its mechanism is not clear. Increased glycogen synthase kinase-3 (GSK-3) activity can also improve cardiac hypertrophy. However, the relationship between proteasome and GSK-3 has not been reported in cardiomyocyte In this study, we will investigate the effect of proteasome inhibition on cardiomyocyte hypertrophy, GSK-3 activity and the underlying mechanism. Methods Primary neonatal rat cardiomyocytes were divided into 4 groups: Control, Ang H (100 nmol · L^-1 48 h) Ang Ⅱ ( 100 nmol · L^-1) + MG132 (0.05 μmol · L^-1) MG132 (0.05 μmol · L^-1) ,Ang 11 (100 nmol · L^-1 ) + MG132 + LiC1 ( 10 mmol · L^-1 ), LiC1. Proteasome activitiy was detected by fluorescent peptide substrate. Cardiomyocyte surface area, ANF mRNA expression, and the rate of protein synthesis were observed as myocardial hypertrophy index. GSK-3, Akt, AMPKoL, and Histone3 (H3) were detected by Western Blot. The expression of GATA4 in the cytoplasm and nucleus was observed by im- munofluorescence. Results (1) Compared with the control group, myocardial ANF mRNA expression, the rate of protein synthesis and cell surface area were all increased in Ang H group. The chymotrypsin-like, trypsin-like and caspase-like activities of proteasome were all increased significantly. The phosphorylated level of both GSK-3α( p- GSK-3α) ( Ser21 ) and GSK-3β (p-GSK-3β ) (Ser9) increased, i. e they were inactivated. (2) Compared with the Ang II group, myocardial ANF mRNA expression, the rate of protein synthesis and cell surface area were all decreased after proteasome inhibition. And p-GSK-3 (Ser21) and p-GSK-3β (Ser9) was respondingly decreased, (3) Proteasome inhibition also resulted in the decrease of p-Akt (Ser473) and p-AMPKa (Thr172)7 which in- creased in cardiomyocyte hypertrophy. Immunofluorescence showed that GATA4 was mainly distributed in the nu- cleus after Ang II treatment, while it was obviously increased in the cytoplasm after proteasome inhibition. After the GSK-3 inhibitor-LiC1 was given, the above indicators were reversed. (4) p-Histone3 was also increased in cardio- myocyte hypertrophy and MG132 reduced its level, but LiC1 treatment had no significant effect on its level. Con- clusion Proteasome inhibition reduces cardiomyocyte hypertrophy through increase of GSK-3a/b activity, which may be related with the decrease of Akt and AMPKa activities, and the decrease of nucleus location of GATA4, but p-histone3 is not involved.
文摘OBJECTIVE Microglial activation-mediated neuroinflammation plays an important pathological basis in the progression of many neurodegenerative diseases.Activated microglia cells show a metabolic shift from oxidative phos⁃phorylation to aerobic glycolysis.However,the molecular mechanism underlying the role of glycolysis in microglial activation and progres⁃sion of neuroinflammatory diseases have not yet been fully understood.METHODS The anti-inflammatory effects and its underlying mecha⁃nisms of glycolytic inhibition in vitro were exam⁃ined in lipopolysaccharide(LPS)activated BV-2 microglial cells or primary microglial cells by enzyme-linked immunosorbent assay(ELISA),quantitative reverse transcriptase polymerase chain reaction(RT-PCR),Western blotting,immunoprecipitation,Flow cytometry and nuclear factor kappa B(NF-κB)luciferase reporter assays.In vivo,the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine(MPTP)-or LPS-induced Par⁃kinson disease(PD)models were constructed to explored the anti-inflammatory and neuropro⁃tective effects of glycolytic inhibitor.RESULTS Inhibition of glycolysis by specific inhibitors[2-DG and 3-bromopyruvic acid(3-BPA)],knockdown of glucose transporter type 1(Glut-1)or hexoki⁃nase(HK)Ⅱabolished LPS-induced expres⁃sion of proinflammatory genes in microglia cells.Mechanistic studies demonstrated that glyco⁃lytic inhibitors significantly inhibited LPS-induced mTOR phosphorylation,IKKβphosphorylation,IκB phosphorylation,IκB degradation,nuclear translocation of P65 and NF-κB luciferase activity.Furthermore,LPS-induced P65 acetyla⁃tion on lysine 310,which is mediated by NAD-dependent protein deacetylase sirtuin-1 and is critical for NF-kB activation,were inhibited by glycolytic inhibitors.A coculture study revealed that 2-DG reduced the cytotoxicity of activated microglia toward MES23.5 dopaminergic neuron cells with no direct protective effect.In vivo,2-DG significantly ameliorated MPTP or LPS induced DA neuron loss and glial cell activation.CONCLUSION Glycolysis is actively involved in microglial activation.Inhibition of glycolysis can ameliorate microglial activation-related neuroinflammatory diseases.
文摘A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT (vincristine, 175 fold-resistancehigher than that in original KB cells) and ADM(adriamycin, 14. 5 fold) resulting over-expression ofMDRl. We used the primers for antisense RNA asfollowing: upstream 5′OGAATTCTGAAACCTGTAAGCAGCAACC 3′: downstream
文摘OBJECTIVE Prepulse inhibition(PPI)of the acoustic startle response provides a measure of sensorimotor gating system mecha⁃nisms,which is known to be impaired in schizo⁃phrenia patients.We assessed the effects of the 5-HT2A/2C receptor agonist(±)2,5-dimethoxy-4-methylamphetamine(DOM),the NMDA receptor antagonist ketamine,the dopamine receptor ago⁃nist methamphetamine(Meth)on PPI and the startle magnitude in SD rats.METHODS AND RESULTS Systemic administration of the three compounds all dose-dependently reduced PPI.However,as far as startle magnitude,only DOM at the doses of 3 mg·kg-1 reduced that,while both ketamine and Meth did not change the startle magnitudes.Furthermore,to determine whether 5-HT2A receptor mediate this effect,the non-spe⁃cific 5-HT2 receptor antagonist cyproheptadine,specific 5-HT2A receptor antagonist ketanserin and specific 5-HT2C receptor antagonist SB242084 were tested.Cyproheptadine,ketan⁃serin and SB242084 did not alter startle ampli⁃tude by themselves in SD rats and only ketanserin slightly increased PPI at higher dose(3 mg·kg-1).PPI impairment induced by DOM was restored by pretreatment of cyproheptadine(1 mg·kg-1)and ketanserin(1 mg·kg-1),while not by pretreat⁃ment of SB242084(1 mg·kg-1).Damage of PPI induced by ketamine and Meth was not reversed by cyproheptadine(1 and 5 mg·kg-1).CONCLU⁃SION The receptor mechanisms underlying the disruption of PPI caused by DOM,ketamine and Meth were different from each other,at least 5-HT2A receptor was not the junction receptor for which the three chemicals acted.
基金supported by a grant from the key project of the National Natural Science Foundation of China (to QinghuaZHOU)(No. 30430300)National Natural Science Foundation of China (to Qinghua ZHOU)(No. 30670922)INTERNATION Scienc and Techniquie COOPRATION PROGRAM OF CHINA (ISCP) (to Qinghua ZHOU)(No.2006DFB32330)
文摘Background and Objective Lung cancer, which has been proved to have fastest increasing rate of morbidity and mortality, appears to be one of the most dangerous malignant tumor that
文摘We have examined the theoretical implications of combining two main and three auxiliary ligands to form several Ir(Ⅲ)complexes featuring a transition metal as their core atom to identify some appropriate organic lightemitting diode(OLED)materials.By utilizing electronic structure,frontier molecular orbitals,minimum single-line absorption,triplet excited states,and emission spectral data derived from the density functional theory,the usefulness of these Ir(Ⅲ)complexes,including(piq)_(2)Ir(acac),(piq)_(2)Ir(tmd),(piq)_(2)Ir(tpip),(fpiq)_(2)Ir(acac),(fpiq)_(2)Ir(tmd),and(fpiq)_(2)Ir(tpip),in OLEDs was examined,where piq=1-phenylisoquinoline,fpiq=1-(4-fluorophenyl)isoquinoline,acac=(3Z)-4-hydroxypent-3-en-2-one,tmd=(4Z)-5-hydroxy-2,2,6,6-tetramethylhept-4-en-3-one,and tpip=tetraphenylimido-diphosphonate.These complexes all have low-efficiency roll-off properties,especially(fpiq)_(2)Ir(tpip).Some researchers have successfully synthesized complexes extremely similar to(piq)_(2)Ir(acac)through the Suzuki-Miyaura coupling reaction.
基金CABin grant(F.no.Agril.Edn.4-1/2013-A&P)Indian Council of Agricul-tural Research,Ministry of Agriculture and Farmers’Welfare,Govt.of India and Department of Biotechnology,Govt.of India for BIC project grant(BT/PR40161/BTIS/137/32/2021)。
文摘Background Polygalacturonase inhibiting proteins(PGIPs)play a pivotal role in plant defense against plant patho-gens by inhibiting polygalacturonase(PG),an enzyme produced by pathogens to degrade plant cell wall pectin.PGIPs,also known as leucine-rich repeat pathogenesis-related(PR)proteins,activate the host’s defense response upon interaction with PG,thereby reinforcing the host defense against plant pathogens attacks.In Egyptian or extra-long staple cotton(Gossypium barbadense),the interaction between PGIP and PG is one of the crucial steps in the defense mechanism against major pathogens such as Xanthomonas citri pv.malvacearum and Alternaria mac-rospora,which are responsible for bacterial leaf blight and leaf spot diseases,respectively.Results To unravel the molecular mechanisms underlying these PR proteins,we conducted a comprehensive study involving molecular modeling,protein-protein docking,site-specific double mutation(E169G and F242K),and molec-ular dynamics simulations.Both wild-type and mutated cotton PGIPs were examined in the interaction with the PG enzyme of a bacterial and fungal pathogen.Our findings revealed that changes in conformations of double-mutated residues in the active site of PGIP lead to the inhibition of PG binding.The molecular dynamics simulation studies provide insights into the dynamic behaviour and stability of the PGIP-PG complexes,shedding light on the intricate details of the inhibitory and exhibitory mechanism against the major fungal and bacterial pathogens of G.barbadense,respectively.Conclusions The findings of this study not only enhance our understanding of the molecular interactions between PGs of Xanthomonas citri pv.malvacearum and Alternaria macrospora and PGIP of G.barbadense but also pre-sent a potential strategy for developing the disease-resistant cotton varieties.By variations in the binding affinities of PGs through specific mutations in PGIP,this research offers promising avenues for the development of enhanced resistance to cotton plants against bacterial leaf blight and leaf spot diseases.
基金Project(52204164)supported by the National Natural Science Foundation of ChinaProject(2021QNRC001)supported by the Young Elite Scientists Sponsorship Program by CAST,China。
文摘The intersection is a widely used traffic line structure from the shallow tunnel to the deep roadway,and determining the subsidence hidden danger area of the roof is the key to its stability control.However,applying traditional maximum equivalent span beam(MESB)theory to determine deformation range,peak point,and angle influence poses a challenge.Considering the overall structure of the intersection roof,the maximum equivalent triangular plate(METP)theory is proposed,and its geometric parameter calculation formula and deflection calculation formula are obtained.The application of the two theories in 18 models with different intersection angles,roadway types,and surrounding rock lithology is verified by numerical analysis.The results show that:1)The METP structure of the intersection roof established by the simulation results of each model successfully determined the location of the roof’s high displacement zone;2)The area comparison method of the METP theory can be reasonably explained:①The roof subsidence of the intersection decreases with the increase of the intersection angle;②The roof subsidence at the intersection of different roadway types has a rectangular type>arch type>circular type;③The roof subsidence of the intersection with weak surrounding rock is significantly larger than that of the intersection with hard surrounding rock.According to the application results of the two theories,the four advantages of the METP theory are compared and clarified in the basic assumptions,mechanical models,main viewpoints,and mechanism analysis.The large deformation inducement of the intersection roof is then explored.The J 2 peak area of the roof drives the large deformation of the area,the peak point of which is consistent with the center of gravity position of the METP.Furthermore,the change in the range of this peak is consistent with the change law of the METP’s area.Hence,this theory clarifies the large deformation area of the intersection roof,which provides a clear guiding basis for its initial support design,mid-term monitoring,and late local reinforcement.